Incidental Mutation 'R1885:Kdm5d'
ID209503
Institutional Source Beutler Lab
Gene Symbol Kdm5d
Ensembl Gene ENSMUSG00000056673
Gene Namelysine (K)-specific demethylase 5D
SynonymsJarid1d, Smcy, HY
MMRRC Submission 039906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1885 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location897788-956786 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) G to T at 940781 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055032] [ENSMUST00000186696] [ENSMUST00000186726]
Predicted Effect probably null
Transcript: ENSMUST00000055032
SMART Domains Protein: ENSMUSP00000061095
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
Pfam:zf-C5HC2 706 758 5.2e-18 PFAM
Pfam:PLU-1 771 1096 1.4e-89 PFAM
low complexity region 1147 1156 N/A INTRINSIC
low complexity region 1164 1181 N/A INTRINSIC
PHD 1182 1243 2.54e-6 SMART
coiled coil region 1290 1318 N/A INTRINSIC
low complexity region 1340 1351 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1453 1459 N/A INTRINSIC
low complexity region 1525 1541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186696
SMART Domains Protein: ENSMUSP00000140663
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
low complexity region 675 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186726
SMART Domains Protein: ENSMUSP00000140462
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 1.4e-25 SMART
ARID 76 165 3.8e-40 SMART
BRIGHT 80 170 2.3e-40 SMART
Blast:ARID 175 260 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189955
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
Brip1 C A 11: 86,138,815 G631V probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Kdm5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0426:Kdm5d UTSW Y 942437 splice site probably benign
R0486:Kdm5d UTSW Y 927107 missense probably damaging 1.00
R0620:Kdm5d UTSW Y 927330 missense probably damaging 0.98
R0781:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1015:Kdm5d UTSW Y 941687 missense possibly damaging 0.95
R1110:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1163:Kdm5d UTSW Y 898029 missense probably benign 0.18
R1203:Kdm5d UTSW Y 941011 missense probably damaging 1.00
R1238:Kdm5d UTSW Y 941282 missense probably damaging 1.00
R1723:Kdm5d UTSW Y 927753 missense probably damaging 1.00
R1842:Kdm5d UTSW Y 927798 missense probably damaging 1.00
R2131:Kdm5d UTSW Y 941483 missense probably benign 0.02
R2571:Kdm5d UTSW Y 940932 missense probably benign 0.11
R2931:Kdm5d UTSW Y 942992 missense probably benign 0.18
R3123:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R3919:Kdm5d UTSW Y 939914 missense probably damaging 1.00
R4018:Kdm5d UTSW Y 910441 splice site probably benign
R4031:Kdm5d UTSW Y 916910 missense probably damaging 1.00
R4403:Kdm5d UTSW Y 899830 missense probably damaging 1.00
R4571:Kdm5d UTSW Y 927110 missense probably damaging 1.00
R4583:Kdm5d UTSW Y 914134 missense probably damaging 1.00
R4962:Kdm5d UTSW Y 940624 missense probably damaging 1.00
R5105:Kdm5d UTSW Y 941752 missense probably benign 0.00
R5249:Kdm5d UTSW Y 916692 missense probably damaging 1.00
R5367:Kdm5d UTSW Y 941645 missense probably benign 0.05
R5373:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5374:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5876:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R5909:Kdm5d UTSW Y 941306 missense probably benign 0.01
R6014:Kdm5d UTSW Y 921528 missense probably benign 0.45
R6109:Kdm5d UTSW Y 921501 missense probably damaging 1.00
R6251:Kdm5d UTSW Y 921693 missense probably damaging 1.00
R6349:Kdm5d UTSW Y 916847 missense probably damaging 0.99
R6450:Kdm5d UTSW Y 927056 missense probably damaging 1.00
R6595:Kdm5d UTSW Y 939829 missense probably benign
R6628:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R6745:Kdm5d UTSW Y 927112 missense probably benign 0.28
R6867:Kdm5d UTSW Y 927425 missense probably benign
R6963:Kdm5d UTSW Y 937975 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTACCCCTGTTTGGATGATTTGG -3'
(R):5'- AGCCCCAGCAATTCTGTGTC -3'

Sequencing Primer
(F):5'- ATGATTTGGAGGGCCTTGTAGC -3'
(R):5'- CAATCCACCGACTGCGCTTG -3'
Posted On2014-06-30