Incidental Mutation 'R0118:Cpn2'
ID20951
Institutional Source Beutler Lab
Gene Symbol Cpn2
Ensembl Gene ENSMUSG00000023176
Gene Namecarboxypeptidase N, polypeptide 2
Synonyms
MMRRC Submission 038404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0118 (G1)
Quality Score224
Status Validated (trace)
Chromosome16
Chromosomal Location30256378-30267499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30260368 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 172 (R172G)
Ref Sequence ENSEMBL: ENSMUSP00000069318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064856]
Predicted Effect probably benign
Transcript: ENSMUST00000064856
AA Change: R172G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000069318
Gene: ENSMUSG00000023176
AA Change: R172G

DomainStartEndE-ValueType
LRRNT 21 53 3.21e-8 SMART
LRR 96 119 1.22e2 SMART
LRR 120 143 5.11e0 SMART
LRR_TYP 144 167 2.71e-2 SMART
LRR_TYP 168 191 3.21e-4 SMART
LRR_TYP 192 215 5.9e-3 SMART
LRR_TYP 216 239 6.88e-4 SMART
LRR 240 263 6.57e-1 SMART
LRR_TYP 264 287 2.12e-4 SMART
LRR 289 311 3.07e-1 SMART
LRR_TYP 312 335 2.61e-4 SMART
LRR_TYP 336 359 5.9e-3 SMART
LRR_TYP 360 383 2.79e-4 SMART
LRRCT 395 446 7.34e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231234
Meta Mutation Damage Score 0.1532 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 89.3%
  • 20x: 67.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T C 9: 30,911,744 R343G probably damaging Het
Asxl2 T G 12: 3,496,923 V569G probably damaging Het
Azin2 A C 4: 128,949,637 H85Q probably damaging Het
Cacna1a C T 8: 84,536,083 R324C probably damaging Het
Ccdc151 A T 9: 21,995,057 N224K probably benign Het
Ccr3 C A 9: 124,029,610 Y327* probably null Het
Cers2 T C 3: 95,320,226 F55S probably benign Het
Cic C T 7: 25,286,034 S301L probably damaging Het
Cntnap2 T C 6: 45,060,392 probably null Het
Ctdnep1 T C 11: 69,988,731 probably null Het
Dennd3 T A 15: 73,565,076 Y1051N probably damaging Het
Dmap1 T G 4: 117,676,483 Y196S probably damaging Het
Entpd7 G A 19: 43,704,312 W102* probably null Het
Frem2 A T 3: 53,535,243 C2624* probably null Het
Gdpd3 A G 7: 126,770,993 Y238C probably damaging Het
Gjb3 A G 4: 127,326,658 V27A probably damaging Het
Kat6b T C 14: 21,669,974 F1465L probably damaging Het
Klra17 A T 6: 129,831,589 M227K probably benign Het
Map6 A G 7: 99,317,617 D348G possibly damaging Het
Mapkbp1 T C 2: 120,025,215 S1472P probably benign Het
Megf6 C A 4: 154,254,641 P545Q probably damaging Het
Mertk C T 2: 128,759,166 R357W probably damaging Het
Mesd T A 7: 83,895,627 I104N probably damaging Het
Mrm3 T A 11: 76,249,955 V263E possibly damaging Het
Ndst4 T A 3: 125,611,561 Y488* probably null Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nfs1 T C 2: 156,134,524 H150R probably damaging Het
Olfr1500 A G 19: 13,827,565 F277S possibly damaging Het
Olfr27 T A 9: 39,144,103 M1K probably null Het
Olfr353 A G 2: 36,890,023 M275T probably benign Het
Olfr923 T C 9: 38,827,858 S50P possibly damaging Het
Pcdh8 T C 14: 79,767,408 Y1059C probably damaging Het
Pik3r5 T A 11: 68,490,480 L164Q probably damaging Het
Polr3g T C 13: 81,676,121 probably benign Het
Ppm1e T A 11: 87,231,738 K464N probably benign Het
Rims1 T C 1: 22,346,407 T1037A probably damaging Het
Rpgrip1l A T 8: 91,270,122 I108N probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Spem1 T C 11: 69,821,545 K98E possibly damaging Het
St7l T C 3: 104,889,303 V237A probably damaging Het
Tbc1d16 T C 11: 119,157,816 H337R probably damaging Het
Tbc1d32 T A 10: 56,017,605 I1291F probably benign Het
Tnfaip6 G T 2: 52,043,815 E61* probably null Het
Trib2 A T 12: 15,793,928 W102R probably damaging Het
Uimc1 G T 13: 55,085,644 N66K probably damaging Het
Vmn1r63 T A 7: 5,802,839 T265S probably benign Het
Vps35 G A 8: 85,294,953 T3I probably benign Het
Yeats2 T A 16: 20,156,942 L63* probably null Het
Zfp282 A G 6: 47,892,932 R304G probably benign Het
Other mutations in Cpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Cpn2 APN 16 30260520 missense probably benign 0.42
IGL01954:Cpn2 APN 16 30260320 missense probably benign 0.01
IGL02458:Cpn2 APN 16 30260835 missense probably benign 0.00
IGL03036:Cpn2 APN 16 30260829 missense probably benign 0.00
R0541:Cpn2 UTSW 16 30259351 missense possibly damaging 0.73
R1300:Cpn2 UTSW 16 30259663 missense probably benign 0.01
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1751:Cpn2 UTSW 16 30259667 nonsense probably null
R1753:Cpn2 UTSW 16 30260100 missense probably damaging 1.00
R1761:Cpn2 UTSW 16 30260196 missense probably damaging 1.00
R1767:Cpn2 UTSW 16 30259667 nonsense probably null
R1793:Cpn2 UTSW 16 30259324 missense probably damaging 1.00
R2360:Cpn2 UTSW 16 30259503 missense probably benign 0.01
R2414:Cpn2 UTSW 16 30260574 missense probably benign 0.41
R3842:Cpn2 UTSW 16 30260518 missense probably damaging 1.00
R4934:Cpn2 UTSW 16 30260526 missense probably damaging 1.00
R4956:Cpn2 UTSW 16 30260415 missense possibly damaging 0.56
R5593:Cpn2 UTSW 16 30260080 missense probably benign 0.02
R5864:Cpn2 UTSW 16 30259683 missense probably damaging 1.00
R6755:Cpn2 UTSW 16 30260331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCATAGCATCTCTAGGCTGAAC -3'
(R):5'- CCAAGGTGGTCTTCCTCAACACTC -3'

Sequencing Primer
(F):5'- CAGATGTGGGGACAGCTC -3'
(R):5'- TGCAGGACCTGGAGATCAC -3'
Posted On2013-04-11