Incidental Mutation 'R1887:Hc'
ID209615
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 039908-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R1887 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35034611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 435 (I435V)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
AA Change: I435V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: I435V

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.1%
  • 10x: 93.2%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
4930544D05Rik A G 11: 70,616,423 E98G probably damaging Het
Abca8a A T 11: 110,089,942 M90K probably damaging Het
Adamts9 A G 6: 92,872,788 probably null Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
AF067061 G T 13: 120,264,068 K89N probably damaging Het
Akr1c18 T A 13: 4,143,288 N126I probably benign Het
Ankmy2 T A 12: 36,170,468 M51K possibly damaging Het
Apc A G 18: 34,272,468 E159G probably damaging Het
Arhgef28 G T 13: 98,145,573 S4R probably damaging Het
Atg2b G A 12: 105,654,092 T784M probably benign Het
Atp11a A G 8: 12,812,324 N59D probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Cacna1h T C 17: 25,376,887 Y1875C probably benign Het
Capza1 A T 3: 104,839,780 probably null Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cdcp2 T C 4: 107,102,702 F105L probably damaging Het
Cep152 A T 2: 125,620,305 M58K probably benign Het
Comtd1 A G 14: 21,847,741 L108P probably damaging Het
Cyp2b13 A G 7: 26,088,650 Y401C probably damaging Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Eea1 T A 10: 96,018,211 probably null Het
Fam102a T A 2: 32,560,128 N129K possibly damaging Het
Fam171a1 T C 2: 3,220,343 V157A probably damaging Het
Fam173a C A 17: 25,791,345 probably null Het
Fat3 T A 9: 15,967,061 I3375F probably damaging Het
Fmod A G 1: 134,040,813 E197G possibly damaging Het
Fsd1l T C 4: 53,696,984 probably null Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gpatch1 A T 7: 35,303,388 N232K probably damaging Het
H2-Q4 A G 17: 35,380,137 R128G possibly damaging Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Il23r A T 6: 67,473,801 D231E possibly damaging Het
Kcnt2 T A 1: 140,584,247 S1023T probably damaging Het
Klc2 A G 19: 5,108,612 V618A probably benign Het
Lzts1 T C 8: 69,138,833 D221G probably damaging Het
Mdn1 G C 4: 32,742,540 R3926P probably damaging Het
Med24 A G 11: 98,718,816 probably benign Het
Mga T A 2: 119,923,617 L869Q probably damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mrvi1 A G 7: 110,924,533 probably null Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlrp5 T A 7: 23,417,484 V211D probably damaging Het
Nr1h4 A T 10: 89,454,867 M433K possibly damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr1054 A G 2: 86,333,273 F28L possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pik3cd T A 4: 149,652,634 I902F probably damaging Het
Pip5kl1 A G 2: 32,578,505 T198A probably damaging Het
Prkdc T C 16: 15,829,635 V3641A probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Rpl37 C T 15: 5,118,590 T83M possibly damaging Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Serinc5 A T 13: 92,701,706 D340V possibly damaging Het
Stambpl1 A G 19: 34,236,408 I346V probably benign Het
Syna G A 5: 134,559,252 S281L probably benign Het
Tet2 T C 3: 133,487,333 T447A possibly damaging Het
Tgfbr3 A G 5: 107,137,008 F592L probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Ttc6 T A 12: 57,673,258 S872T probably benign Het
Ttc7b C T 12: 100,415,130 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr4 T C 4: 139,455,560 L419P probably damaging Het
Ush2a C A 1: 188,399,980 Q800K probably benign Het
Vmn2r115 T C 17: 23,346,033 I298T possibly damaging Het
Vmn2r28 T C 7: 5,488,289 T320A possibly damaging Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 intron probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTCATGGCTGGACTTACC -3'
(R):5'- TCTAGGGTTATGTCACACGC -3'

Sequencing Primer
(F):5'- AGTTATTTTGTCGATATATGGGCTC -3'
(R):5'- GGGTTATGTCACACGCCAACTATAC -3'
Posted On2014-06-30