Incidental Mutation 'R1887:Fsd1l'
ID209628
Institutional Source Beutler Lab
Gene Symbol Fsd1l
Ensembl Gene ENSMUSG00000054752
Gene Namefibronectin type III and SPRY domain containing 1-like
SynonymsA230072O16Rik, Csdufd1, Fsd1nl, Ccdc10
MMRRC Submission 039908-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R1887 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53631471-53707009 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 53696984 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132151] [ENSMUST00000159415] [ENSMUST00000163067] [ENSMUST00000180164]
Predicted Effect probably null
Transcript: ENSMUST00000132151
SMART Domains Protein: ENSMUSP00000114931
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 3.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159415
SMART Domains Protein: ENSMUSP00000124002
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 360 480 2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163067
SMART Domains Protein: ENSMUSP00000124613
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 349 469 3.6e-17 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000136849
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 362 479 2.6e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180164
SMART Domains Protein: ENSMUSP00000136184
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 1.4e-7 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 1.2e-16 PFAM
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.1%
  • 10x: 93.2%
  • 20x: 86.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
4930544D05Rik A G 11: 70,616,423 E98G probably damaging Het
Abca8a A T 11: 110,089,942 M90K probably damaging Het
Adamts9 A G 6: 92,872,788 probably null Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Aen A T 7: 78,907,325 D307V probably damaging Het
AF067061 G T 13: 120,264,068 K89N probably damaging Het
Akr1c18 T A 13: 4,143,288 N126I probably benign Het
Ankmy2 T A 12: 36,170,468 M51K possibly damaging Het
Apc A G 18: 34,272,468 E159G probably damaging Het
Arhgef28 G T 13: 98,145,573 S4R probably damaging Het
Atg2b G A 12: 105,654,092 T784M probably benign Het
Atp11a A G 8: 12,812,324 N59D probably damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
Cacna1h T C 17: 25,376,887 Y1875C probably benign Het
Capza1 A T 3: 104,839,780 probably null Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cdcp2 T C 4: 107,102,702 F105L probably damaging Het
Cep152 A T 2: 125,620,305 M58K probably benign Het
Comtd1 A G 14: 21,847,741 L108P probably damaging Het
Cyp2b13 A G 7: 26,088,650 Y401C probably damaging Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dmxl1 G A 18: 49,859,135 R316H probably benign Het
Eea1 T A 10: 96,018,211 probably null Het
Fam102a T A 2: 32,560,128 N129K possibly damaging Het
Fam171a1 T C 2: 3,220,343 V157A probably damaging Het
Fam173a C A 17: 25,791,345 probably null Het
Fat3 T A 9: 15,967,061 I3375F probably damaging Het
Fmod A G 1: 134,040,813 E197G possibly damaging Het
Gbp2b A G 3: 142,608,302 T448A probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Gpatch1 A T 7: 35,303,388 N232K probably damaging Het
H2-Q4 A G 17: 35,380,137 R128G possibly damaging Het
Hc T C 2: 35,034,611 I435V probably benign Het
Hmgxb3 A G 18: 61,137,401 probably null Het
Il23r A T 6: 67,473,801 D231E possibly damaging Het
Kcnt2 T A 1: 140,584,247 S1023T probably damaging Het
Klc2 A G 19: 5,108,612 V618A probably benign Het
Lzts1 T C 8: 69,138,833 D221G probably damaging Het
Mdn1 G C 4: 32,742,540 R3926P probably damaging Het
Med24 A G 11: 98,718,816 probably benign Het
Mga T A 2: 119,923,617 L869Q probably damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Mrvi1 A G 7: 110,924,533 probably null Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nlrp5 T A 7: 23,417,484 V211D probably damaging Het
Nr1h4 A T 10: 89,454,867 M433K possibly damaging Het
Ofcc1 T C 13: 40,206,624 S310G possibly damaging Het
Olfr1054 A G 2: 86,333,273 F28L possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Pdlim7 C T 13: 55,506,168 G212D probably benign Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pik3cd T A 4: 149,652,634 I902F probably damaging Het
Pip5kl1 A G 2: 32,578,505 T198A probably damaging Het
Prkdc T C 16: 15,829,635 V3641A probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Rpl37 C T 15: 5,118,590 T83M possibly damaging Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Serinc5 A T 13: 92,701,706 D340V possibly damaging Het
Stambpl1 A G 19: 34,236,408 I346V probably benign Het
Syna G A 5: 134,559,252 S281L probably benign Het
Tet2 T C 3: 133,487,333 T447A possibly damaging Het
Tgfbr3 A G 5: 107,137,008 F592L probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Trip4 T A 9: 65,874,881 I190F probably null Het
Ttc6 T A 12: 57,673,258 S872T probably benign Het
Ttc7b C T 12: 100,415,130 probably null Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr4 T C 4: 139,455,560 L419P probably damaging Het
Ush2a C A 1: 188,399,980 Q800K probably benign Het
Vmn2r115 T C 17: 23,346,033 I298T possibly damaging Het
Vmn2r28 T C 7: 5,488,289 T320A possibly damaging Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Other mutations in Fsd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fsd1l APN 4 53682187 missense probably damaging 1.00
IGL01019:Fsd1l APN 4 53694742 missense probably damaging 1.00
IGL01154:Fsd1l APN 4 53701074 missense probably benign 0.01
IGL01359:Fsd1l APN 4 53659601 missense possibly damaging 0.78
IGL01996:Fsd1l APN 4 53647760 missense probably benign 0.00
IGL02192:Fsd1l APN 4 53647754 missense probably benign
IGL02629:Fsd1l APN 4 53686417 missense probably damaging 1.00
R0009:Fsd1l UTSW 4 53687209 missense probably benign 0.01
R0166:Fsd1l UTSW 4 53647664 splice site probably null
R0255:Fsd1l UTSW 4 53694727 missense probably damaging 1.00
R0349:Fsd1l UTSW 4 53679854 missense probably damaging 0.97
R0409:Fsd1l UTSW 4 53679932 missense probably benign 0.00
R1886:Fsd1l UTSW 4 53696984 splice site probably null
R2039:Fsd1l UTSW 4 53679972 missense probably benign 0.02
R2289:Fsd1l UTSW 4 53696931 missense possibly damaging 0.64
R4577:Fsd1l UTSW 4 53686397 missense probably damaging 1.00
R5134:Fsd1l UTSW 4 53647766 missense probably benign 0.43
R6073:Fsd1l UTSW 4 53679994 missense probably damaging 1.00
R6216:Fsd1l UTSW 4 53694742 missense probably damaging 1.00
R7184:Fsd1l UTSW 4 53694054 missense probably damaging 1.00
R7285:Fsd1l UTSW 4 53682200 critical splice donor site probably null
R7423:Fsd1l UTSW 4 53686406 missense probably damaging 1.00
R7465:Fsd1l UTSW 4 53647755 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATATGTCTTTTGGCATGCTCATCTG -3'
(R):5'- CATTAAAGTCCAAGACAAGGGC -3'

Sequencing Primer
(F):5'- GGCATGCTCATCTGTTTAACTTAG -3'
(R):5'- GGCTAACCCTTCCAGAAGAG -3'
Posted On2014-06-30