Incidental Mutation 'R1895:Stil'
ID209721
Institutional Source Beutler Lab
Gene Symbol Stil
Ensembl Gene ENSMUSG00000028718
Gene NameScl/Tal1 interrupting locus
SynonymsSil
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115000159-115043196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115023875 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 539 (S539P)
Ref Sequence ENSEMBL: ENSMUSP00000030490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933]
Predicted Effect probably benign
Transcript: ENSMUST00000030490
AA Change: S539P

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: S539P

DomainStartEndE-ValueType
Pfam:STIL_N 22 426 5.1e-199 PFAM
low complexity region 709 724 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129957
SMART Domains Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 416 1.5e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130401
Predicted Effect probably benign
Transcript: ENSMUST00000141933
SMART Domains Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 392 6.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144316
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Stil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Stil APN 4 115024112 missense probably benign 0.29
IGL01672:Stil APN 4 115032789 missense probably damaging 1.00
IGL02058:Stil APN 4 115014162 missense probably benign 0.00
IGL02076:Stil APN 4 115023637 missense probably benign 0.03
IGL02104:Stil APN 4 115041482 missense probably damaging 1.00
IGL02355:Stil APN 4 115010111 missense probably damaging 1.00
IGL02362:Stil APN 4 115010111 missense probably damaging 1.00
IGL02612:Stil APN 4 115023696 missense possibly damaging 0.80
IGL02695:Stil APN 4 115016175 missense probably damaging 1.00
IGL02696:Stil APN 4 115041495 missense probably damaging 0.99
IGL02826:Stil APN 4 115024098 missense probably benign 0.01
IGL02946:Stil APN 4 115029913 missense probably benign 0.05
IGL03146:Stil APN 4 115024415 missense probably damaging 1.00
R0058:Stil UTSW 4 115041298 missense probably damaging 1.00
R0256:Stil UTSW 4 115023685 missense possibly damaging 0.80
R0324:Stil UTSW 4 115039149 missense probably benign 0.01
R0391:Stil UTSW 4 115041172 critical splice acceptor site probably null
R0602:Stil UTSW 4 115024423 splice site probably benign
R0620:Stil UTSW 4 115007159 missense possibly damaging 0.52
R1452:Stil UTSW 4 115039195 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1544:Stil UTSW 4 115023852 missense probably damaging 0.97
R1789:Stil UTSW 4 115041782 missense probably benign 0.01
R1878:Stil UTSW 4 115041226 missense probably damaging 1.00
R2325:Stil UTSW 4 115032707 missense probably benign 0.12
R2401:Stil UTSW 4 115016286 missense probably null 0.81
R3054:Stil UTSW 4 115004966 missense probably damaging 1.00
R3055:Stil UTSW 4 115014069 splice site probably benign
R4097:Stil UTSW 4 115023600 missense probably benign 0.04
R4330:Stil UTSW 4 115004979 missense probably damaging 1.00
R4418:Stil UTSW 4 115009377 missense probably benign 0.17
R4665:Stil UTSW 4 115041644 missense probably benign 0.00
R4688:Stil UTSW 4 115041308 missense probably damaging 1.00
R4740:Stil UTSW 4 115006782 missense probably benign 0.15
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4909:Stil UTSW 4 115024225 nonsense probably null
R6130:Stil UTSW 4 115029861 splice site probably null
R6523:Stil UTSW 4 115032714 frame shift probably null
Z1088:Stil UTSW 4 115006693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCCAAACACAGCTCAG -3'
(R):5'- TGGCCATGATGCTGACAAC -3'

Sequencing Primer
(F):5'- TCAGTTAAGTCAGGACACTGC -3'
(R):5'- CTGACAACAGCTGCAGACGTTTG -3'
Posted On2014-06-30