Incidental Mutation 'R1895:Fbxo44'
ID209723
Institutional Source Beutler Lab
Gene Symbol Fbxo44
Ensembl Gene ENSMUSG00000029001
Gene NameF-box protein 44
SynonymsFBG3, Fbx6a, FBX30, Fbxo6a
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148152800-148160482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 148156269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 220 (R220S)
Ref Sequence ENSEMBL: ENSMUSP00000134624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000047951] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000122913] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000134261] [ENSMUST00000151127] [ENSMUST00000151246] [ENSMUST00000152098] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000172472] [ENSMUST00000173352]
Predicted Effect probably benign
Transcript: ENSMUST00000030858
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047951
SMART Domains Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556

DomainStartEndE-ValueType
Pfam:F-box 50 97 3.8e-9 PFAM
Pfam:F-box-like 51 97 9.3e-8 PFAM
FBA 114 297 3.81e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056965
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057907
AA Change: R167S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105705
AA Change: A126P

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001
AA Change: A126P

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105706
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122913
SMART Domains Protein: ENSMUSP00000120874
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 115 3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129253
AA Change: R167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132083
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134261
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151127
AA Change: R167S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134064
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 235 4.09e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151246
AA Change: R167S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152098
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153703
AA Change: R99S
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001
AA Change: R99S

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167160
AA Change: R167S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168503
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173352
AA Change: R220S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134624
Gene: ENSMUSG00000029001
AA Change: R220S

DomainStartEndE-ValueType
FBOX 62 103 1.37e-2 SMART
FBA 121 254 3.86e-50 SMART
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Several alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Fbxo44
AlleleSourceChrCoordTypePredicted EffectPPH Score
trompo UTSW 4 148156004 missense probably benign
R0040:Fbxo44 UTSW 4 148158695 missense probably damaging 1.00
R0737:Fbxo44 UTSW 4 148158809 utr 5 prime probably benign
R0850:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R0899:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1169:Fbxo44 UTSW 4 148155976 missense probably benign 0.01
R1423:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1889:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R3712:Fbxo44 UTSW 4 148156004 missense probably benign
R3774:Fbxo44 UTSW 4 148156594 missense probably damaging 1.00
R3834:Fbxo44 UTSW 4 148156250 missense probably damaging 1.00
R4411:Fbxo44 UTSW 4 148153608 missense probably damaging 1.00
R4810:Fbxo44 UTSW 4 148156446 missense probably damaging 1.00
R5086:Fbxo44 UTSW 4 148156212 missense probably benign 0.00
R5108:Fbxo44 UTSW 4 148158563 missense probably damaging 1.00
R5344:Fbxo44 UTSW 4 148153573 missense probably damaging 0.98
R5423:Fbxo44 UTSW 4 148154229 missense probably benign 0.00
R5930:Fbxo44 UTSW 4 148156595 missense probably damaging 1.00
R6017:Fbxo44 UTSW 4 148158553 missense probably benign 0.17
R6132:Fbxo44 UTSW 4 148156108 missense probably benign 0.10
R6498:Fbxo44 UTSW 4 148154425
X0017:Fbxo44 UTSW 4 148156223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTGTCTAAGCTGGAAGC -3'
(R):5'- TCAAGGCTGAAGGGTATTGG -3'

Sequencing Primer
(F):5'- CTATTCTTCTACTAAAGCAAGTGAGG -3'
(R):5'- GCCCCCTATCTCCCAGG -3'
Posted On2014-06-30