Incidental Mutation 'R1895:Tmem43'
ID209737
Institutional Source Beutler Lab
Gene Symbol Tmem43
Ensembl Gene ENSMUSG00000030095
Gene Nametransmembrane protein 43
Synonyms1200015A22Rik, LUMA
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91473703-91488463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91486909 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 389 (I389F)
Ref Sequence ENSEMBL: ENSMUSP00000032183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000032183]
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032183
AA Change: I389F

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095
AA Change: I389F

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:DUF1625 121 373 3.6e-88 PFAM
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TMEM43 family. Defects in this gene are the cause of familial arrhythmogenic right ventricular dysplasia type 5 (ARVD5), also known as arrhythmogenic right ventricular cardiomyopathy type 5 (ARVC5). Arrhythmogenic right ventricular dysplasia is an inherited disorder, often involving both ventricles, and is characterized by ventricular tachycardia, heart failure, sudden cardiac death, and fibrofatty replacement of cardiomyocytes. This gene contains a response element for PPAR gamma (an adipogenic transcription factor), which may explain the fibrofatty replacement of the myocardium, a characteristic pathological finding in ARVC. [provided by RefSeq, Oct 2008]
PHENOTYPE: In a gihg-throughput screen, female homozygous mutant mice exhibited an increased anxiety-like response during open field activity testing when compared with their gender-matched wild-type littermates and the historical mean. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Tmem43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tmem43 APN 6 91477374 missense possibly damaging 0.73
IGL03105:Tmem43 APN 6 91480700 missense probably damaging 1.00
R0415:Tmem43 UTSW 6 91482318 missense probably benign 0.13
R1388:Tmem43 UTSW 6 91478803 splice site probably null
R1581:Tmem43 UTSW 6 91478735 missense probably benign 0.01
R1777:Tmem43 UTSW 6 91477330 nonsense probably null
R1946:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R2697:Tmem43 UTSW 6 91479929 missense possibly damaging 0.85
R4778:Tmem43 UTSW 6 91482255 missense probably damaging 1.00
R5205:Tmem43 UTSW 6 91486781 missense possibly damaging 0.89
R5366:Tmem43 UTSW 6 91478258 missense probably benign 0.43
R5383:Tmem43 UTSW 6 91473890 missense probably benign 0.00
R5516:Tmem43 UTSW 6 91478210 missense possibly damaging 0.70
R5569:Tmem43 UTSW 6 91477354 missense probably benign 0.01
R5656:Tmem43 UTSW 6 91480708 missense probably benign 0.01
R6490:Tmem43 UTSW 6 91478777 missense probably damaging 0.97
R6490:Tmem43 UTSW 6 91486880 missense possibly damaging 0.91
S24628:Tmem43 UTSW 6 91482318 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGTGGACTGGTTTCCTGTC -3'
(R):5'- GTTCCAGCAATGAGGGATGG -3'

Sequencing Primer
(F):5'- CTTCCGAGACCTTGTCAACATTGG -3'
(R):5'- CTGGGTGGAATGAAGCCC -3'
Posted On2014-06-30