Incidental Mutation 'R1895:Megf11'
ID209758
Institutional Source Beutler Lab
Gene Symbol Megf11
Ensembl Gene ENSMUSG00000036466
Gene Namemultiple EGF-like-domains 11
Synonyms
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1895 (G1)
Quality Score212
Status Validated
Chromosome9
Chromosomal Location64385626-64709205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64679276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 461 (D461V)
Ref Sequence ENSEMBL: ENSMUSP00000114035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068967] [ENSMUST00000093829] [ENSMUST00000118485] [ENSMUST00000164113]
Predicted Effect probably damaging
Transcript: ENSMUST00000068967
AA Change: D461V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065353
Gene: ENSMUSG00000036466
AA Change: D461V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093829
AA Change: D430V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091349
Gene: ENSMUSG00000036466
AA Change: D430V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF_Lam 114 153 9.55e-3 SMART
EGF_Lam 157 196 2e-5 SMART
EGF 195 227 5.57e-4 SMART
EGF_Lam 243 282 1.26e-2 SMART
EGF_Lam 286 326 2.52e-2 SMART
EGF_Lam 330 371 4.16e-3 SMART
EGF 370 402 6.21e-2 SMART
EGF 413 445 4.1e-2 SMART
EGF 456 488 7.02e-1 SMART
EGF_Lam 504 543 1.43e-1 SMART
EGF_Lam 547 586 5.04e-2 SMART
EGF 585 619 8.52e0 SMART
EGF 630 662 9.41e-2 SMART
EGF_Lam 678 717 2.99e-4 SMART
EGF 716 748 1.14e0 SMART
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 821 835 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118485
AA Change: D461V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114035
Gene: ENSMUSG00000036466
AA Change: D461V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 926 941 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124881
AA Change: D51V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120514
Gene: ENSMUSG00000036466
AA Change: D51V

DomainStartEndE-ValueType
EGF_like 3 36 2.79e0 SMART
EGF 35 67 4.1e-2 SMART
EGF 78 110 7.02e-1 SMART
EGF_Lam 126 165 1.43e-1 SMART
EGF 164 196 1.64e-1 SMART
EGF_Lam 212 251 2.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144383
Predicted Effect probably damaging
Transcript: ENSMUST00000164113
AA Change: D461V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128672
Gene: ENSMUSG00000036466
AA Change: D461V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF_Lam 709 748 2.99e-4 SMART
EGF 747 779 1.14e0 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of horizontal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Megf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Megf11 APN 9 64508727 missense probably damaging 1.00
IGL01285:Megf11 APN 9 64660446 missense probably damaging 1.00
IGL01309:Megf11 APN 9 64681416 missense probably benign 0.01
IGL01953:Megf11 APN 9 64690088 missense probably damaging 1.00
IGL02341:Megf11 APN 9 64544620 missense probably damaging 1.00
IGL02407:Megf11 APN 9 64680249 missense probably damaging 1.00
IGL02621:Megf11 APN 9 64693932 missense probably benign 0.07
R0277:Megf11 UTSW 9 64691350 critical splice donor site probably null
R0386:Megf11 UTSW 9 64640078 missense probably damaging 1.00
R1354:Megf11 UTSW 9 64653177 missense probably benign 0.00
R1709:Megf11 UTSW 9 64695412 missense probably damaging 1.00
R1865:Megf11 UTSW 9 64680299 missense probably benign 0.39
R1946:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R2221:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R2223:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R3552:Megf11 UTSW 9 64695463 missense possibly damaging 0.75
R4641:Megf11 UTSW 9 64690125 missense possibly damaging 0.93
R4746:Megf11 UTSW 9 64508745 missense probably damaging 1.00
R5594:Megf11 UTSW 9 64686473 missense probably damaging 1.00
R5716:Megf11 UTSW 9 64506110 missense possibly damaging 0.72
R5898:Megf11 UTSW 9 64685964 missense probably damaging 1.00
R5960:Megf11 UTSW 9 64660449 missense probably benign 0.00
R6372:Megf11 UTSW 9 64706625 missense probably damaging 1.00
R6811:Megf11 UTSW 9 64544641 missense probably damaging 0.99
R6868:Megf11 UTSW 9 64680309 missense probably damaging 1.00
R6984:Megf11 UTSW 9 64686452 missense probably benign
V5088:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
Z1088:Megf11 UTSW 9 64660476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAGCATGGACATCAGG -3'
(R):5'- TATTGTCCCTGCAGACCATGTG -3'

Sequencing Primer
(F):5'- GGAGGAGCACCACCTACAG -3'
(R):5'- TGCAGACCATGTGGCTCAC -3'
Posted On2014-06-30