Incidental Mutation 'R1895:Adgrb1'
ID209771
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1895 (G1)
Quality Score104
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74540465 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 431 (D431G)
Ref Sequence ENSEMBL: ENSMUSP00000046097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]
Predicted Effect probably damaging
Transcript: ENSMUST00000042035
AA Change: D431G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: D431G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186360
AA Change: D431G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: D431G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189200
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
bunting UTSW 15 74543701 missense probably null 0.94
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTGGGTGAGGTAGATTCTCCAGG -3'
(R):5'- TAACCTCTGAGCACCCTGAG -3'

Sequencing Primer
(F):5'- AGGTAGATTCTCCAGGTGGGTG -3'
(R):5'- TGAGCACCCTGAGATGAACCTG -3'
Posted On2014-06-30