Incidental Mutation 'R1889:Col6a3'
ID209786
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90803711 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1000 (M1000L)
Ref Sequence ENSEMBL: ENSMUSP00000140858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]
Predicted Effect probably benign
Transcript: ENSMUST00000056925
AA Change: M1607L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: M1607L

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097653
AA Change: M1000L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: M1000L

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130846
AA Change: M1607L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: M1607L

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
Pfam:VWA 1636 1703 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136916
Predicted Effect probably benign
Transcript: ENSMUST00000188587
AA Change: M1000L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: M1000L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4600:Col6a3 UTSW 1 90781904 missense unknown
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 unclassified probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCAGACACAACCTCGAG -3'
(R):5'- AAGATGGGGTCCCTCAACAC -3'

Sequencing Primer
(F):5'- CAACCTCGAGAGAAGAGAATTATTGC -3'
(R):5'- AACACCTGGTCTTATTCCTGGGTG -3'
Posted On2014-06-30