Incidental Mutation 'R1889:Dpm1'
ID209800
Institutional Source Beutler Lab
Gene Symbol Dpm1
Ensembl Gene ENSMUSG00000078919
Gene Namedolichol-phosphate (beta-D) mannosyltransferase 1
Synonyms
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168209048-168230591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 168217735 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 147 (R147Q)
Ref Sequence ENSEMBL: ENSMUSP00000118776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109193] [ENSMUST00000138667] [ENSMUST00000154111]
Predicted Effect probably benign
Transcript: ENSMUST00000099072
SMART Domains Protein: ENSMUSP00000096671
Gene: ENSMUSG00000078919

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 16 118 1.8e-11 PFAM
Pfam:Glyco_tranf_2_2 20 119 1.3e-8 PFAM
Pfam:Glycos_transf_2 20 119 6.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109193
AA Change: R95Q

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104816
Gene: ENSMUSG00000078919
AA Change: R95Q

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_2 2 101 1.2e-8 PFAM
Pfam:Glycos_transf_2 2 147 7.8e-36 PFAM
Pfam:Glyco_tranf_2_3 2 187 1.2e-11 PFAM
Pfam:Glyco_transf_21 34 148 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136582
Predicted Effect possibly damaging
Transcript: ENSMUST00000138667
AA Change: R147Q

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752
AA Change: R147Q

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153258
Predicted Effect possibly damaging
Transcript: ENSMUST00000154111
AA Change: R147Q

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118776
Gene: ENSMUSG00000078919
AA Change: R147Q

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 241 3.2e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 7.6e-10 PFAM
Pfam:Glycos_transf_2 28 199 8.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156800
Meta Mutation Damage Score 0.0428 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. Mutations in this gene are associated with congenital disorder of glycosylation type Ie. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Dpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Dpm1 APN 2 168210575 missense probably benign 0.37
R0200:Dpm1 UTSW 2 168223155 critical splice acceptor site probably null
R0212:Dpm1 UTSW 2 168227494 missense probably benign 0.00
R1460:Dpm1 UTSW 2 168210629 missense probably damaging 1.00
R1974:Dpm1 UTSW 2 168217747 missense probably damaging 1.00
R4547:Dpm1 UTSW 2 168223153 missense probably damaging 0.98
R4838:Dpm1 UTSW 2 168210536 missense probably damaging 1.00
R4887:Dpm1 UTSW 2 168217759 missense probably benign 0.01
R6919:Dpm1 UTSW 2 168230275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCTGGACAGTATCAGAAATC -3'
(R):5'- CTGGCCTCATGCTTTAGCTG -3'

Sequencing Primer
(F):5'- ATCAAGATTGCTGGCTTTAAGAGG -3'
(R):5'- AGCTGTGCTTCTCTTAAGACTTG -3'
Posted On2014-06-30