Incidental Mutation 'R1889:Sema3d'
ID209810
Institutional Source Beutler Lab
Gene Symbol Sema3d
Ensembl Gene ENSMUSG00000040254
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms4631426B19Rik
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location12383385-12588948 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 12485021 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030868] [ENSMUST00000197927]
Predicted Effect probably null
Transcript: ENSMUST00000030868
SMART Domains Protein: ENSMUSP00000030868
Gene: ENSMUSG00000040254

DomainStartEndE-ValueType
transmembrane domain 16 35 N/A INTRINSIC
Sema 70 515 2.97e-207 SMART
PSI 533 585 2.03e-13 SMART
IG 598 682 1.39e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196618
Predicted Effect probably null
Transcript: ENSMUST00000197927
SMART Domains Protein: ENSMUSP00000142453
Gene: ENSMUSG00000040254

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Sema 70 515 1e-209 SMART
PSI 533 585 8.5e-16 SMART
Blast:Sema 590 622 1e-9 BLAST
Meta Mutation Damage Score 0.6332 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin like domain and a C-terminal basic domain. The protein encoded by this gene binds neuropilin and plays an important role in cardiovascular development. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pulmonary vein connection to the right atrium and atrial septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Sema3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3d APN 5 12563222 missense probably benign 0.01
IGL00582:Sema3d APN 5 12585195 missense probably damaging 1.00
IGL00661:Sema3d APN 5 12505839 missense probably damaging 1.00
IGL00780:Sema3d APN 5 12524326 missense probably damaging 1.00
IGL01531:Sema3d APN 5 12541080 missense probably benign
IGL01957:Sema3d APN 5 12563315 missense probably damaging 1.00
IGL02100:Sema3d APN 5 12584991 missense probably benign 0.29
IGL02676:Sema3d APN 5 12570978 missense probably benign 0.38
IGL02749:Sema3d APN 5 12563145 splice site probably benign
IGL02827:Sema3d APN 5 12585118 missense probably benign 0.04
IGL03325:Sema3d APN 5 12463222 missense probably damaging 0.99
R0050:Sema3d UTSW 5 12584953 missense probably benign 0.00
R0085:Sema3d UTSW 5 12570986 missense probably benign 0.00
R0095:Sema3d UTSW 5 12563347 missense probably damaging 1.00
R0157:Sema3d UTSW 5 12508137 missense possibly damaging 0.95
R0328:Sema3d UTSW 5 12448075 missense possibly damaging 0.48
R0924:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R0930:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R1609:Sema3d UTSW 5 12541056 missense probably damaging 1.00
R1657:Sema3d UTSW 5 12584974 missense possibly damaging 0.82
R1669:Sema3d UTSW 5 12508084 splice site probably benign
R1795:Sema3d UTSW 5 12584887 missense probably benign 0.02
R1861:Sema3d UTSW 5 12497603 missense probably benign 0.00
R1895:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1946:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12563318 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12584998 missense probably benign
R2117:Sema3d UTSW 5 12563273 missense probably benign
R2148:Sema3d UTSW 5 12484959 missense probably damaging 0.99
R2276:Sema3d UTSW 5 12542582 missense possibly damaging 0.63
R3761:Sema3d UTSW 5 12571037 missense probably damaging 1.00
R4063:Sema3d UTSW 5 12585124 missense probably benign 0.25
R4428:Sema3d UTSW 5 12448120 missense probably benign 0.32
R4903:Sema3d UTSW 5 12563158 missense probably benign 0.00
R4999:Sema3d UTSW 5 12508087 splice site probably null
R5000:Sema3d UTSW 5 12448038 missense probably benign 0.01
R5022:Sema3d UTSW 5 12584956 missense probably damaging 1.00
R5186:Sema3d UTSW 5 12584908 missense probably benign
R5584:Sema3d UTSW 5 12566008 missense possibly damaging 0.49
R5584:Sema3d UTSW 5 12570987 missense possibly damaging 0.73
R6270:Sema3d UTSW 5 12448107 missense probably benign
R6368:Sema3d UTSW 5 12571013 missense probably damaging 1.00
R6426:Sema3d UTSW 5 12563264 missense probably damaging 1.00
R6750:Sema3d UTSW 5 12585100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAAAGCCGTGGTTGATG -3'
(R):5'- AAATCCAACCTCAGCTCAGGTG -3'

Sequencing Primer
(F):5'- CCAAAGCCGTGGTTGATGTCTAC -3'
(R):5'- CACTACGTTGCAGAAGCTAGCTTTG -3'
Posted On2014-06-30