Incidental Mutation 'R1889:Cep295'
ID209834
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Namecentrosomal protein 295
SynonymsLOC382128, 5830418K08Rik
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15316915-15357788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15332103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1686 (T1686A)
Ref Sequence ENSEMBL: ENSMUSP00000123788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066038
Predicted Effect probably benign
Transcript: ENSMUST00000098979
AA Change: T1686A

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: T1686A

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160946
AA Change: T430A
SMART Domains Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: T430A

DomainStartEndE-ValueType
coiled coil region 92 119 N/A INTRINSIC
low complexity region 282 293 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
coiled coil region 451 480 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161132
AA Change: T1686A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: T1686A

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161795
AA Change: T1638A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: T1638A

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
internal_repeat_1 842 1056 7.14e-5 PROSPERO
internal_repeat_1 1229 1441 7.14e-5 PROSPERO
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 1955 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162264
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 unclassified probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 unclassified probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTATCTGAGAACCCACTGCAAC -3'
(R):5'- TGTTTCTGTCCAAGGAAATAGAGC -3'

Sequencing Primer
(F):5'- TTAAATTCAGAACATACCTGACTGAC -3'
(R):5'- TGTCCAAGGAAATAGAGCATCCATTC -3'
Posted On2014-06-30