Incidental Mutation 'R1889:Ap1g2'
ID209851
Institutional Source Beutler Lab
Gene Symbol Ap1g2
Ensembl Gene ENSMUSG00000040701
Gene Nameadaptor protein complex AP-1, gamma 2 subunit
Synonymsgamma 2-adaptin, Adtg2
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1889 (G1)
Quality Score165
Status Validated
Chromosome14
Chromosomal Location55098575-55106593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55101429 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 532 (M532L)
Ref Sequence ENSEMBL: ENSMUSP00000128427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036041] [ENSMUST00000050575] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000151314] [ENSMUST00000170285] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect probably damaging
Transcript: ENSMUST00000036041
AA Change: M532L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701
AA Change: M532L

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050575
SMART Domains Protein: ENSMUSP00000056026
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
CYTH 5 200 1.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144197
Predicted Effect probably benign
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153702
Predicted Effect probably damaging
Transcript: ENSMUST00000170285
AA Change: M532L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701
AA Change: M532L

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcnx3 T C 19: 5,672,656 D1336G probably damaging Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Ap1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1g2 APN 14 55105114 missense probably benign 0.01
IGL02421:Ap1g2 APN 14 55102402 missense probably damaging 1.00
IGL02633:Ap1g2 APN 14 55100647 splice site probably null
IGL02967:Ap1g2 APN 14 55105022 splice site probably benign
IGL03030:Ap1g2 APN 14 55106047 missense probably damaging 1.00
IGL03087:Ap1g2 APN 14 55103036 missense probably damaging 0.99
IGL03261:Ap1g2 APN 14 55100530 missense probably benign 0.00
IGL03308:Ap1g2 APN 14 55104876 missense probably benign 0.44
R0284:Ap1g2 UTSW 14 55101692 splice site probably benign
R0614:Ap1g2 UTSW 14 55099773 missense probably benign 0.00
R0762:Ap1g2 UTSW 14 55100411 splice site probably benign
R1561:Ap1g2 UTSW 14 55104887 missense probably damaging 1.00
R1938:Ap1g2 UTSW 14 55099772 missense possibly damaging 0.80
R1997:Ap1g2 UTSW 14 55102378 missense probably benign 0.00
R2169:Ap1g2 UTSW 14 55099340 critical splice acceptor site probably null
R3157:Ap1g2 UTSW 14 55099274 missense probably damaging 0.96
R3820:Ap1g2 UTSW 14 55100573 splice site probably benign
R3850:Ap1g2 UTSW 14 55104906 missense probably benign 0.03
R4750:Ap1g2 UTSW 14 55104365 missense probably damaging 1.00
R4909:Ap1g2 UTSW 14 55105026 critical splice donor site probably null
R5305:Ap1g2 UTSW 14 55099076 missense probably benign
R5880:Ap1g2 UTSW 14 55102700 missense probably damaging 1.00
R6243:Ap1g2 UTSW 14 55099073 missense probably benign
R6964:Ap1g2 UTSW 14 55099265 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTTCCACTCCAGGATGAGAG -3'
(R):5'- ACCTCCTGCTGGAAGGTAAC -3'

Sequencing Primer
(F):5'- TCCACTCCAGGATGAGAGGGAAG -3'
(R):5'- ACGGAGCCTTTTCAGGTGAGAC -3'
Posted On2014-06-30