Incidental Mutation 'R1889:Pcnx3'
ID209869
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 039910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1889 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5672656 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1336 (D1336G)
Ref Sequence ENSEMBL: ENSMUSP00000109245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615]
Predicted Effect probably damaging
Transcript: ENSMUST00000068169
AA Change: D928G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: D928G

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113615
AA Change: D1336G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: D1336G

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137313
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145270
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146638
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.6%
  • 20x: 88.0%
Validation Efficiency 97% (103/106)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik A G 9: 89,152,762 noncoding transcript Het
9130008F23Rik T C 17: 40,880,302 R79G probably damaging Het
Aco1 A T 4: 40,164,607 probably null Het
Acp6 C T 3: 97,165,885 R81W probably damaging Het
Agbl1 A C 7: 76,589,381 Y543S probably damaging Het
Anapc7 T C 5: 122,433,476 W205R probably damaging Het
Ap1g2 T A 14: 55,101,429 M532L probably damaging Het
Appl1 A G 14: 26,925,513 probably benign Het
Arhgef19 T C 4: 141,249,313 F462S probably damaging Het
Astn1 A G 1: 158,505,316 probably null Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cadm2 T C 16: 66,882,795 D50G probably damaging Het
Ccdc81 G A 7: 89,882,294 Q324* probably null Het
Cd300lf A G 11: 115,120,380 V178A probably benign Het
Cdt1 T C 8: 122,572,052 V476A possibly damaging Het
Cenpj A G 14: 56,558,725 V225A probably benign Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Cfap54 A G 10: 93,034,710 S684P possibly damaging Het
Clip1 C A 5: 123,653,496 V204F probably damaging Het
Cnpy4 A G 5: 138,192,840 E226G probably benign Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Cpsf1 T C 15: 76,602,156 M335V probably benign Het
Dnmt3b C A 2: 153,676,759 A614E probably benign Het
Dpm1 C T 2: 168,217,735 R147Q possibly damaging Het
Dpp7 G T 2: 25,353,679 probably null Het
Engase T C 11: 118,478,933 F57S probably damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gkn2 T A 6: 87,378,155 Y115* probably null Het
Gtdc1 A G 2: 44,591,914 S246P probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Herc2 C T 7: 56,189,813 S3357L possibly damaging Het
Herc6 T A 6: 57,662,075 Y840* probably null Het
Hoxa10 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG 6: 52,234,492 probably benign Het
Ift122 T C 6: 115,894,421 probably null Het
Ilf3 T A 9: 21,404,767 probably benign Het
Itgb2 A T 10: 77,548,623 N193Y possibly damaging Het
Itgb5 T G 16: 33,910,469 I65S probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Kcnt2 A T 1: 140,584,293 H995L probably damaging Het
Kif20b T C 19: 34,941,208 probably benign Het
Kif7 T C 7: 79,710,463 Y342C probably damaging Het
Klhl21 T C 4: 152,015,420 V529A possibly damaging Het
Klhl26 T C 8: 70,451,733 D475G probably damaging Het
Lcor T C 19: 41,559,128 Y384H probably damaging Het
Lrp1b A T 2: 40,919,167 C2463* probably null Het
March6 T C 15: 31,459,193 E909G possibly damaging Het
Mrc1 A T 2: 14,308,677 probably null Het
Nipal4 T A 11: 46,150,733 I212F probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Nwd2 A G 5: 63,807,666 E1531G possibly damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr204 T G 16: 59,314,963 Y148S probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Opa1 T C 16: 29,625,585 V863A possibly damaging Het
Pabpc4l A T 3: 46,446,363 M282K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phlpp1 T C 1: 106,318,850 V590A possibly damaging Het
Rbck1 T A 2: 152,318,356 T468S probably damaging Het
Ripor2 T A 13: 24,693,887 I290N probably damaging Het
Rnf139 T C 15: 58,899,497 L457P probably damaging Het
Rtn1 C A 12: 72,304,410 A342S possibly damaging Het
Sema3d A G 5: 12,485,021 probably null Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Sez6l2 T C 7: 126,953,496 V148A probably damaging Het
Shank2 C A 7: 144,186,858 S568* probably null Het
Skiv2l2 T C 13: 112,887,490 N707S probably benign Het
Slc10a4 T C 5: 73,012,147 S372P possibly damaging Het
Slc10a5 T C 3: 10,335,490 T37A probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Slc6a20b G T 9: 123,632,204 D52E probably benign Het
Slc6a5 T C 7: 49,951,434 M661T probably benign Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Steap4 G T 5: 7,975,892 R151L probably damaging Het
Sun5 T A 2: 153,865,995 I107L probably benign Het
Tacc1 C T 8: 25,175,253 V488M probably damaging Het
Tgs1 A G 4: 3,614,928 T829A probably benign Het
Tnxb A G 17: 34,695,825 E1929G probably damaging Het
Tssc4 A C 7: 143,070,555 Q200P probably damaging Het
Ttn A G 2: 76,758,532 W21398R probably damaging Het
Usp50 C T 2: 126,777,898 probably null Het
Usp9y A T Y: 1,448,829 probably null Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Zfat T C 15: 68,101,539 T1118A probably benign Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
buns UTSW 19 5683340 start codon destroyed probably null
Pastries UTSW 19 5683339 nonsense probably null
pecan UTSW 19 5672615 missense probably damaging 1.00
pie UTSW 19 5667158 missense possibly damaging 0.81
swirls UTSW 19 5672515 missense probably damaging 1.00
tip UTSW 19 5683780 splice site probably benign
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
R7177:Pcnx3 UTSW 19 5687499 missense probably benign 0.01
R7308:Pcnx3 UTSW 19 5686147 missense possibly damaging 0.52
R7387:Pcnx3 UTSW 19 5673336 missense probably benign 0.33
R7488:Pcnx3 UTSW 19 5667459 missense possibly damaging 0.72
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCATTGCCAACCTCAATG -3'
(R):5'- ATCTACTCACAGCTCAGGGATG -3'

Sequencing Primer
(F):5'- CTCAATGAGGTGCACTAGCG -3'
(R):5'- TGCTGATGAGCTGCCTGAC -3'
Posted On2014-06-30