Incidental Mutation 'R0119:Zzef1'
ID20992
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission 038405-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R0119 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72821851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 199 (V199A)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect probably benign
Transcript: ENSMUST00000069395
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: V199A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150551
Predicted Effect probably benign
Transcript: ENSMUST00000172220
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: V199A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207107
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adamts18 A G 8: 113,774,953 I346T possibly damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap3d1 A G 10: 80,723,615 probably benign Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Cap1 A T 4: 122,867,699 L130Q probably damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Caskin2 A G 11: 115,802,427 probably benign Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Cd96 T C 16: 46,038,579 probably benign Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1c A T 8: 93,106,717 probably benign Het
Ces1c A T 8: 93,107,610 L351M probably benign Het
Cnih3 T A 1: 181,454,744 probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Cry1 A G 10: 85,133,240 probably null Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Elmo3 T C 8: 105,309,768 L668S probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Gm839 A T 6: 89,212,380 noncoding transcript Het
Gng5 T A 3: 146,503,293 C39S probably damaging Het
Gpr55 C T 1: 85,941,424 W145* probably null Het
Hdlbp A C 1: 93,421,337 probably benign Het
Man2a2 G T 7: 80,367,405 N305K probably damaging Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mier3 T C 13: 111,715,038 V490A probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Mug2 T A 6: 122,036,063 H311Q probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Obox3 T A 7: 15,626,327 probably null Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pcdh15 T C 10: 74,170,575 F95S probably damaging Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Per3 A G 4: 151,024,548 probably benign Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Rere T G 4: 150,615,322 probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Sh3bgrl3 A T 4: 134,128,036 I33N probably damaging Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Sppl3 T A 5: 115,088,994 probably benign Het
Tacc2 C A 7: 130,621,875 Q116K probably damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tnpo3 A G 6: 29,568,922 V477A possibly damaging Het
Trim7 G T 11: 48,849,712 R212L probably damaging Het
Trpm6 T A 19: 18,832,593 C1118S probably benign Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Zbtb18 A G 1: 177,448,157 E361G probably benign Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 synonymous probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TCAGTTCAGATGGGGCAGCAGATAC -3'
(R):5'- TGGGGACCAAACGCAAGTCATCAG -3'

Sequencing Primer
(F):5'- ACAGGATGTGGGAACTATTGTG -3'
(R):5'- CAGGCTGAACATTCTTAGGCTAC -3'
Posted On2013-04-11