Incidental Mutation 'R1903:Cnot1'
ID209941
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 039923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1903 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95743121 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1369 (I1369V)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: I1369V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I1369V

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083155
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: I1374V

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I1374V

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: I1367V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: I1374V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,258,352 S246R possibly damaging Het
Abca13 C T 11: 9,466,411 R4058C probably benign Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adam22 C T 5: 8,134,525 C489Y probably damaging Het
Agap3 A T 5: 24,493,013 K460I probably damaging Het
Ak4 T C 4: 101,463,636 I214T possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arrb2 T A 11: 70,437,982 H221Q probably damaging Het
Atl1 T G 12: 69,959,275 F452V probably damaging Het
Atp8b5 A G 4: 43,357,063 T604A probably damaging Het
BC005561 T A 5: 104,518,330 S239R probably benign Het
Bglap3 T C 3: 88,368,761 I95V probably benign Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Ccnl1 A G 3: 65,946,911 S430P possibly damaging Het
Cdk5rap2 A T 4: 70,403,554 probably null Het
Cep126 A T 9: 8,120,747 Y92N possibly damaging Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnga1 T G 5: 72,616,725 D90A possibly damaging Het
Coq3 T C 4: 21,910,466 S314P probably damaging Het
Crhr1 A G 11: 104,169,849 R151G probably damaging Het
Crybg2 A G 4: 134,078,856 I930V probably damaging Het
Ctcf T A 8: 105,675,988 probably null Het
Dct T C 14: 118,034,278 N380S probably benign Het
Decr2 A T 17: 26,087,413 L83Q probably damaging Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dgkb T C 12: 38,166,777 probably null Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnajc13 A C 9: 104,228,937 L346R probably damaging Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
Duox2 T A 2: 122,295,351 I296F probably damaging Het
Ece2 T A 16: 20,645,172 L890H probably damaging Het
Ecsit A G 9: 22,076,519 S75P possibly damaging Het
Enpp3 A G 10: 24,778,789 C664R probably damaging Het
Evpl G T 11: 116,227,028 D778E probably damaging Het
Eya3 T A 4: 132,721,352 probably null Het
Fam217b A T 2: 178,420,581 I113F probably benign Het
Galnt6 G A 15: 100,716,118 P101S possibly damaging Het
Gm11487 T A 4: 73,403,438 Y120F probably damaging Het
Gm281 C T 14: 13,829,657 S695N possibly damaging Het
Gm379 G A X: 108,664,264 Q210* probably null Het
Grk4 A T 5: 34,676,187 probably null Het
Gtf3c4 A G 2: 28,839,956 V91A probably benign Het
Hcfc2 G T 10: 82,702,558 G143V probably damaging Het
Heatr4 A C 12: 83,958,447 H710Q probably damaging Het
Htr3a A T 9: 48,906,381 D97E probably damaging Het
Htr4 T G 18: 62,428,122 F151L probably benign Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Invs T A 4: 48,402,824 probably null Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irs1 T C 1: 82,289,461 S345G probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif26a C T 12: 112,175,540 R743C probably damaging Het
Kif28 A G 1: 179,702,523 V691A possibly damaging Het
Klhl5 T A 5: 65,166,987 L696Q probably benign Het
Krtap5-1 T C 7: 142,296,347 probably benign Het
Lama2 A C 10: 27,188,399 D1195E probably damaging Het
Lamb1 T G 12: 31,329,210 L1722R probably damaging Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Ltbp2 T C 12: 84,830,105 E422G probably benign Het
Man2b1 T A 8: 85,086,822 D214E probably damaging Het
Mlxipl A T 5: 135,133,568 D628V possibly damaging Het
Myo18b G A 5: 112,692,758 R2390C probably damaging Het
Mypn T A 10: 63,123,397 R1048S probably benign Het
Napepld A G 5: 21,665,272 S383P probably damaging Het
Napsa A G 7: 44,581,736 T130A probably damaging Het
Nbr1 T C 11: 101,575,152 I716T probably damaging Het
Nexn A T 3: 152,248,181 M212K probably damaging Het
Nlrp9b T A 7: 20,023,257 S140T probably benign Het
Nxpe2 T C 9: 48,319,606 T488A probably benign Het
Olfr1051 C T 2: 86,275,846 V214I probably benign Het
Olfr1420 A T 19: 11,896,549 Y176F probably benign Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr834 A T 9: 18,988,896 K303* probably null Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pan2 T G 10: 128,308,368 L162R probably damaging Het
Parp1 G T 1: 180,588,670 V545F probably damaging Het
Pcdh18 A G 3: 49,755,447 V473A probably benign Het
Plb1 A T 5: 32,291,238 N350I probably damaging Het
Polr1a A G 6: 71,967,914 K1318R probably benign Het
Ppp1r18 C T 17: 35,873,846 P130S probably damaging Het
Prss48 C T 3: 85,998,307 W86* probably null Het
Rab3c A T 13: 110,084,210 I137N probably damaging Het
Rab3gap2 G C 1: 185,221,902 R57P probably benign Het
Rad54l2 A C 9: 106,693,717 probably null Het
Ralgapb C A 2: 158,495,563 N1147K probably benign Het
Rfx7 C T 9: 72,616,811 R428C probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Shprh T A 10: 11,183,797 Y1097* probably null Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Slc24a4 T A 12: 102,131,617 D79E probably benign Het
Slc7a13 A T 4: 19,839,254 I286F probably benign Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Spata31d1b T C 13: 59,718,068 L1010P probably damaging Het
Sult2a1 T C 7: 13,835,975 S111G possibly damaging Het
Tecpr2 C T 12: 110,947,912 T1219M probably damaging Het
Tesk1 T C 4: 43,446,998 M462T probably benign Het
Tmem171 C A 13: 98,686,416 G292* probably null Het
Tmtc2 G T 10: 105,190,108 T833N probably benign Het
Tnc G T 4: 64,000,062 T1204K probably benign Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Tnrc18 G A 5: 142,815,140 S21F probably damaging Het
Tns4 T C 11: 99,075,575 T425A probably damaging Het
Tox T A 4: 6,688,948 Y472F probably damaging Het
Trak2 A T 1: 58,918,855 probably null Het
Trim33 T A 3: 103,337,444 Y716N probably damaging Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Ube2j2 A G 4: 155,949,026 K19R probably benign Het
Ubxn2b T C 4: 6,208,889 I206T possibly damaging Het
Usp40 A G 1: 87,982,056 F559L probably benign Het
Utp4 T A 8: 106,912,350 probably null Het
Vac14 A G 8: 110,682,534 N524S probably benign Het
Vps13c T C 9: 67,894,052 S605P probably damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zdhhc19 C T 16: 32,498,413 R28* probably null Het
Zfp106 T C 2: 120,526,848 I1189V probably benign Het
Zfp189 C T 4: 49,529,511 Q205* probably null Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTCACTGCCACAAACTAGAAGTC -3'
(R):5'- TAGCTGCCCCTACTCAAGAG -3'

Sequencing Primer
(F):5'- GGATCAGGATTTGATTCCCAGAACC -3'
(R):5'- ATTATCCAGCTGATTTCTTTGTTCAG -3'
Posted On2014-06-30