Mutagenetix > Incidental Mutation

Incidental Mutation 'R1908:Col6a3'

210017

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

MMRRC Submission

039927-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1908 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90694582-90771710 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 90739421 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Arginine at position 269 (I269R)

Ref Sequence

ENSEMBL: ENSMUSP00000140858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000130846] [ENSMUST00000188587]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000056925
AA Change: I876R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: I876R

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097653
AA Change: I269R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: I269R

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130846
AA Change: I876R

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000115210
Gene: ENSMUSG00000048126
AA Change: I876R

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
Pfam:VWA	1636	1703	1.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136916

Predicted Effect

probably damaging
Transcript: ENSMUST00000188587
AA Change: I269R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: I269R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	A	11: 109,847,924 (GRCm39)	L852F	possibly damaging	Het
Abcc6	T	C	7: 45,669,558 (GRCm39)		probably null	Het
Alg11	T	G	8: 22,555,584 (GRCm39)	C240G	probably damaging	Het
Aox1	A	G	1: 58,141,783 (GRCm39)	I1190V	probably damaging	Het
Apc2	T	G	10: 80,150,678 (GRCm39)	S1911A	probably benign	Het
Arfgef3	T	C	10: 18,528,511 (GRCm39)	D292G	possibly damaging	Het
Arhgef4	C	A	1: 34,763,340 (GRCm39)	S865R	probably benign	Het
Ass1	T	A	2: 31,383,160 (GRCm39)	Y190*	probably null	Het
B4galnt3	A	T	6: 120,187,051 (GRCm39)		probably null	Het
Btnl10	C	A	11: 58,811,367 (GRCm39)	P230Q	possibly damaging	Het
C3	A	G	17: 57,516,489 (GRCm39)	Y1348H	probably damaging	Het
Ccdc198	G	T	14: 49,464,032 (GRCm39)	D292E	probably damaging	Het
Cebpz	A	T	17: 79,242,336 (GRCm39)	Y439*	probably null	Het
Cic	C	A	7: 24,986,265 (GRCm39)	T1229K	probably damaging	Het
Clip4	T	C	17: 72,144,744 (GRCm39)	S524P	probably damaging	Het
Dbh	C	T	2: 27,071,506 (GRCm39)	T533I	possibly damaging	Het
Dcaf17	A	T	2: 70,890,713 (GRCm39)	R83*	probably null	Het
Dennd2b	G	A	7: 109,124,533 (GRCm39)	Q686*	probably null	Het
Dnah1	A	G	14: 30,984,515 (GRCm39)	L3923P	probably damaging	Het
Dnah7a	A	T	1: 53,670,721 (GRCm39)	D510E	probably benign	Het
Dock6	A	G	9: 21,752,925 (GRCm39)	F296S	probably damaging	Het
Eif4enif1	T	C	11: 3,177,455 (GRCm39)	S341P	probably damaging	Het
Epb41l1	G	T	2: 156,352,737 (GRCm39)	G461V	possibly damaging	Het
Epg5	T	A	18: 78,002,247 (GRCm39)	D555E	probably benign	Het
Fes	T	C	7: 80,036,609 (GRCm39)	R113G	probably damaging	Het
Garre1	T	A	7: 33,957,461 (GRCm39)	I59L	probably benign	Het
Gm10684	A	G	9: 45,021,511 (GRCm39)		probably benign	Het
Gm12185	T	C	11: 48,806,231 (GRCm39)	E320G	probably benign	Het
Gm14412	G	T	2: 177,007,269 (GRCm39)	H209N	probably damaging	Het
Gm14412	A	C	2: 177,007,630 (GRCm39)	S88R	probably benign	Het
Grhl1	T	A	12: 24,658,555 (GRCm39)	L400Q	probably damaging	Het
Havcr1	T	A	11: 46,664,511 (GRCm39)	Y216*	probably null	Het
Hephl1	A	C	9: 14,985,420 (GRCm39)	Y745*	probably null	Het
Hmcn2	T	G	2: 31,301,922 (GRCm39)		probably null	Het
Hs3st6	A	G	17: 24,977,110 (GRCm39)	K197E	possibly damaging	Het
Ifi214	C	T	1: 173,357,077 (GRCm39)	V9I	probably benign	Het
Jakmip2	T	C	18: 43,700,209 (GRCm39)	T450A	probably benign	Het
Lrp4	T	A	2: 91,328,753 (GRCm39)	V1551D	possibly damaging	Het
Macf1	A	T	4: 123,351,634 (GRCm39)	H1634Q	possibly damaging	Het
Mcpt8	T	A	14: 56,321,291 (GRCm39)	I58F	probably benign	Het
Mga	T	A	2: 119,757,075 (GRCm39)	H1018Q	possibly damaging	Het
Myo10	T	A	15: 25,801,308 (GRCm39)	V1499E	probably damaging	Het
Myom2	G	T	8: 15,131,023 (GRCm39)	D320Y	probably damaging	Het
Or11g7	T	A	14: 50,691,295 (GRCm39)	M262K	probably damaging	Het
Or13a27	T	C	7: 139,925,378 (GRCm39)	I175V	probably benign	Het
Or2r11	C	T	6: 42,437,360 (GRCm39)	V198M	probably benign	Het
Or2t26	A	C	11: 49,039,101 (GRCm39)	N6H	possibly damaging	Het
Or4c115	G	A	2: 88,927,888 (GRCm39)	P128S	probably damaging	Het
Or5d47	A	T	2: 87,804,403 (GRCm39)	V202D	possibly damaging	Het
Pabpc4	G	T	4: 123,182,861 (GRCm39)	R166L	possibly damaging	Het
Pcdhb8	A	G	18: 37,489,015 (GRCm39)	E231G	possibly damaging	Het
Pomgnt2	A	T	9: 121,811,257 (GRCm39)	I508N	possibly damaging	Het
Ppp2r5e	C	G	12: 75,516,341 (GRCm39)	A239P	probably damaging	Het
Prdm15	G	T	16: 97,638,885 (GRCm39)	D58E	probably benign	Het
Rgl2	A	G	17: 34,151,122 (GRCm39)	T117A	probably benign	Het
Rp1	A	G	1: 4,418,943 (GRCm39)	I723T	probably damaging	Het
Serpina3g	A	G	12: 104,207,536 (GRCm39)	E233G	probably damaging	Het
Skint6	T	A	4: 112,749,187 (GRCm39)	S798C	probably benign	Het
Slc35f1	T	C	10: 52,898,000 (GRCm39)	L137P	possibly damaging	Het
Slc6a20a	T	C	9: 123,485,373 (GRCm39)	N246S	probably damaging	Het
Slc7a2	T	C	8: 41,369,534 (GRCm39)	L663S	probably benign	Het
Slco1a4	A	G	6: 141,761,173 (GRCm39)		probably null	Het
Slit2	A	G	5: 48,439,330 (GRCm39)	T41A	probably damaging	Het
Smc2	T	C	4: 52,450,863 (GRCm39)	I227T	probably damaging	Het
Smg1	A	G	7: 117,753,422 (GRCm39)		probably benign	Het
Ssu2	A	T	6: 112,361,388 (GRCm39)	L23M	probably benign	Het
Syne2	A	G	12: 76,141,053 (GRCm39)		probably null	Het
Tekt1	T	C	11: 72,242,761 (GRCm39)	T249A	probably benign	Het
Tfr2	T	C	5: 137,569,954 (GRCm39)	V120A	probably benign	Het
Thsd7b	C	T	1: 129,605,846 (GRCm39)	P529L	probably damaging	Het
Tll1	C	T	8: 64,478,141 (GRCm39)	D871N	probably damaging	Het
Tlr11	A	C	14: 50,598,664 (GRCm39)	I217L	probably benign	Het
Tmem87b	T	A	2: 128,673,479 (GRCm39)	V241D	probably damaging	Het
Tshz2	T	A	2: 169,727,465 (GRCm39)	I218N	possibly damaging	Het
Vmn1r18	A	T	6: 57,367,026 (GRCm39)	I176N	possibly damaging	Het
Vmn2r68	T	A	7: 84,883,260 (GRCm39)	H164L	probably benign	Het
Vmn2r74	T	C	7: 85,601,650 (GRCm39)	T663A	probably benign	Het
Vmn2r8	T	C	5: 108,945,436 (GRCm39)	T724A	probably benign	Het
Wdr11	T	C	7: 129,206,954 (GRCm39)	V289A	possibly damaging	Het
Zfp62	T	A	11: 49,107,047 (GRCm39)	D379E	probably damaging	Het
Zfp78	C	T	7: 6,381,897 (GRCm39)	P316S	probably damaging	Het
Zfyve27	T	G	19: 42,159,987 (GRCm39)	M1R	probably null	Het
Zkscan8	G	A	13: 21,709,325 (GRCm39)	P191L	probably damaging	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90,755,977 (GRCm39)	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90,709,748 (GRCm39)	missense	unknown
IGL00541:Col6a3	APN	1	90,729,864 (GRCm39)	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90,730,054 (GRCm39)	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90,731,655 (GRCm39)	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90,735,232 (GRCm39)	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90,730,236 (GRCm39)	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90,706,884 (GRCm39)	missense	unknown
IGL01827:Col6a3	APN	1	90,730,041 (GRCm39)	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90,724,293 (GRCm39)	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90,700,770 (GRCm39)	missense	unknown
IGL01900:Col6a3	APN	1	90,722,732 (GRCm39)	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90,729,958 (GRCm39)	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90,709,858 (GRCm39)	splice site	probably benign
IGL02115:Col6a3	APN	1	90,735,373 (GRCm39)	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90,709,482 (GRCm39)	missense	unknown
IGL02313:Col6a3	APN	1	90,739,328 (GRCm39)	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90,706,919 (GRCm39)	missense	unknown
IGL02821:Col6a3	APN	1	90,731,600 (GRCm39)	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90,724,281 (GRCm39)	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90,739,242 (GRCm39)	nonsense	probably null
IGL03129:Col6a3	APN	1	90,749,584 (GRCm39)	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90,731,615 (GRCm39)	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90,755,588 (GRCm39)	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90,737,898 (GRCm39)	missense	probably damaging	1.00
bailey	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
barnum	UTSW	1	90,706,874 (GRCm39)	missense	unknown
Boneless	UTSW	1	90,706,781 (GRCm39)	missense	unknown
Noodloid	UTSW	1	90,707,011 (GRCm39)	missense	unknown
randolf	UTSW	1	90,715,673 (GRCm39)	missense	unknown
stringy	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
wonder	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90,737,970 (GRCm39)	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90,706,516 (GRCm39)	missense	unknown
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90,725,883 (GRCm39)	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90,741,273 (GRCm39)	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90,725,895 (GRCm39)	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90,735,426 (GRCm39)	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90,755,771 (GRCm39)	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R0512:Col6a3	UTSW	1	90,749,520 (GRCm39)	intron	probably benign
R0564:Col6a3	UTSW	1	90,735,456 (GRCm39)	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90,735,808 (GRCm39)	splice site	probably null
R0667:Col6a3	UTSW	1	90,755,823 (GRCm39)	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90,706,703 (GRCm39)	missense	unknown
R0736:Col6a3	UTSW	1	90,731,811 (GRCm39)	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90,756,020 (GRCm39)	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90,730,375 (GRCm39)	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90,722,047 (GRCm39)	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1225:Col6a3	UTSW	1	90,739,238 (GRCm39)	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90,696,069 (GRCm39)	missense	unknown
R1387:Col6a3	UTSW	1	90,750,138 (GRCm39)	intron	probably benign
R1437:Col6a3	UTSW	1	90,729,098 (GRCm39)	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1677:Col6a3	UTSW	1	90,749,583 (GRCm39)	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90,701,224 (GRCm39)	missense	unknown
R1711:Col6a3	UTSW	1	90,757,935 (GRCm39)	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90,724,296 (GRCm39)	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90,706,781 (GRCm39)	missense	unknown
R1738:Col6a3	UTSW	1	90,744,083 (GRCm39)	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90,741,516 (GRCm39)	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90,755,671 (GRCm39)	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90,757,936 (GRCm39)	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1919:Col6a3	UTSW	1	90,750,081 (GRCm39)	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90,731,897 (GRCm39)	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90,709,733 (GRCm39)	missense	unknown
R2121:Col6a3	UTSW	1	90,738,087 (GRCm39)	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90,731,467 (GRCm39)	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90,741,080 (GRCm39)	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90,731,435 (GRCm39)	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90,703,321 (GRCm39)	missense	unknown
R3052:Col6a3	UTSW	1	90,729,852 (GRCm39)	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90,707,803 (GRCm39)	missense	unknown
R4007:Col6a3	UTSW	1	90,730,291 (GRCm39)	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90,749,605 (GRCm39)	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90,729,105 (GRCm39)	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90,714,361 (GRCm39)	missense	unknown
R4297:Col6a3	UTSW	1	90,739,100 (GRCm39)	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90,709,626 (GRCm39)	missense	unknown
R4683:Col6a3	UTSW	1	90,701,179 (GRCm39)	missense	unknown
R4788:Col6a3	UTSW	1	90,700,672 (GRCm39)	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90,707,011 (GRCm39)	missense	unknown
R4899:Col6a3	UTSW	1	90,730,149 (GRCm39)	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90,729,164 (GRCm39)	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90,735,246 (GRCm39)	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90,731,940 (GRCm39)	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90,706,565 (GRCm39)	missense	unknown
R5057:Col6a3	UTSW	1	90,743,852 (GRCm39)	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90,707,074 (GRCm39)	missense	unknown
R5105:Col6a3	UTSW	1	90,725,862 (GRCm39)	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90,696,067 (GRCm39)	missense	unknown
R5166:Col6a3	UTSW	1	90,738,330 (GRCm39)	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90,701,361 (GRCm39)	nonsense	probably null
R5196:Col6a3	UTSW	1	90,744,260 (GRCm39)	splice site	probably null
R5230:Col6a3	UTSW	1	90,716,776 (GRCm39)	missense	unknown
R5268:Col6a3	UTSW	1	90,712,965 (GRCm39)	missense	unknown
R5381:Col6a3	UTSW	1	90,703,334 (GRCm39)	missense	unknown
R5392:Col6a3	UTSW	1	90,729,017 (GRCm39)	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90,709,761 (GRCm39)	nonsense	probably null
R5571:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R5665:Col6a3	UTSW	1	90,755,602 (GRCm39)	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90,729,921 (GRCm39)	splice site	probably null
R5914:Col6a3	UTSW	1	90,703,922 (GRCm39)	missense	unknown
R5955:Col6a3	UTSW	1	90,739,163 (GRCm39)	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90,749,571 (GRCm39)	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90,696,105 (GRCm39)	missense	unknown
R6010:Col6a3	UTSW	1	90,701,219 (GRCm39)	missense	unknown
R6025:Col6a3	UTSW	1	90,755,824 (GRCm39)	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90,741,475 (GRCm39)	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90,701,387 (GRCm39)	missense	unknown
R6181:Col6a3	UTSW	1	90,744,096 (GRCm39)	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90,750,063 (GRCm39)	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90,749,955 (GRCm39)	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90,738,285 (GRCm39)	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90,709,534 (GRCm39)	missense	unknown
R6484:Col6a3	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6703:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6703:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6724:Col6a3	UTSW	1	90,706,874 (GRCm39)	missense	unknown
R6746:Col6a3	UTSW	1	90,706,767 (GRCm39)	missense	unknown
R6797:Col6a3	UTSW	1	90,731,810 (GRCm39)	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90,722,731 (GRCm39)	splice site	probably null
R6903:Col6a3	UTSW	1	90,721,929 (GRCm39)	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90,743,724 (GRCm39)	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90,735,192 (GRCm39)	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90,755,759 (GRCm39)	nonsense	probably null
R7182:Col6a3	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
R7294:Col6a3	UTSW	1	90,756,005 (GRCm39)	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90,755,708 (GRCm39)	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90,750,013 (GRCm39)	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90,755,855 (GRCm39)	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90,703,463 (GRCm39)	missense	unknown
R7575:Col6a3	UTSW	1	90,738,321 (GRCm39)	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90,709,467 (GRCm39)	missense	unknown
R7679:Col6a3	UTSW	1	90,739,473 (GRCm39)	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90,724,268 (GRCm39)	nonsense	probably null
R7855:Col6a3	UTSW	1	90,738,343 (GRCm39)	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R8003:Col6a3	UTSW	1	90,703,455 (GRCm39)	missense	unknown
R8007:Col6a3	UTSW	1	90,705,179 (GRCm39)	missense	unknown
R8098:Col6a3	UTSW	1	90,731,383 (GRCm39)	missense	probably benign
R8312:Col6a3	UTSW	1	90,741,412 (GRCm39)	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90,729,935 (GRCm39)	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90,727,747 (GRCm39)	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8744:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90,696,171 (GRCm39)	missense	unknown
R8857:Col6a3	UTSW	1	90,703,485 (GRCm39)	missense	unknown
R8867:Col6a3	UTSW	1	90,715,673 (GRCm39)	missense	unknown
R8887:Col6a3	UTSW	1	90,755,948 (GRCm39)	missense	probably benign
R9011:Col6a3	UTSW	1	90,710,057 (GRCm39)	splice site	probably benign
R9049:Col6a3	UTSW	1	90,707,066 (GRCm39)	missense	unknown
R9142:Col6a3	UTSW	1	90,706,566 (GRCm39)	missense	unknown
R9155:Col6a3	UTSW	1	90,738,301 (GRCm39)	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9258:Col6a3	UTSW	1	90,700,703 (GRCm39)	missense	unknown
R9274:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9276:Col6a3	UTSW	1	90,735,403 (GRCm39)	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90,738,979 (GRCm39)	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90,709,523 (GRCm39)	missense	unknown
R9377:Col6a3	UTSW	1	90,743,961 (GRCm39)	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90,731,585 (GRCm39)	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90,744,155 (GRCm39)	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90,707,068 (GRCm39)	missense	unknown
R9441:Col6a3	UTSW	1	90,705,249 (GRCm39)	nonsense	probably null
R9477:Col6a3	UTSW	1	90,706,621 (GRCm39)	missense	unknown
R9498:Col6a3	UTSW	1	90,713,650 (GRCm39)	nonsense	probably null
R9528:Col6a3	UTSW	1	90,731,789 (GRCm39)	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90,731,497 (GRCm39)	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90,738,984 (GRCm39)	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90,738,282 (GRCm39)	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90,731,359 (GRCm39)	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90,731,627 (GRCm39)	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90,739,251 (GRCm39)	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90,739,450 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TGCACGTTATCCTCGATGCG -3'
(R):5'- CTCTCACATCGTGGCAGTAC -3'

Sequencing Primer
(F):5'- GTTATCCTCGATGCGGCTGC -3'
(R):5'- TACGAGGCAGAATGTACTTGATGTC -3'

Posted On

2014-06-30