Incidental Mutation 'R1908:Smc2'
ID210033
Institutional Source Beutler Lab
Gene Symbol Smc2
Ensembl Gene ENSMUSG00000028312
Gene Namestructural maintenance of chromosomes 2
SynonymsCAP-E, Fin16, 5730502P04Rik, Smc2l1
MMRRC Submission 039927-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1908 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location52439243-52488260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52450863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 227 (I227T)
Ref Sequence ENSEMBL: ENSMUSP00000113940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280] [ENSMUST00000142227]
Predicted Effect probably damaging
Transcript: ENSMUST00000102915
AA Change: I227T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312
AA Change: I227T

DomainStartEndE-ValueType
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117280
AA Change: I227T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312
AA Change: I227T

DomainStartEndE-ValueType
Pfam:AAA_21 27 131 3.8e-6 PFAM
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131163
Predicted Effect possibly damaging
Transcript: ENSMUST00000142227
AA Change: I227T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114228
Gene: ENSMUSG00000028312
AA Change: I227T

DomainStartEndE-ValueType
Pfam:SMC_N 2 351 2.3e-36 PFAM
Pfam:AAA_21 27 131 1.7e-8 PFAM
coiled coil region 400 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146787
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,226,575 D292E probably damaging Het
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
Abca8b C A 11: 109,957,098 L852F possibly damaging Het
Abcc6 T C 7: 46,020,134 probably null Het
Alg11 T G 8: 22,065,568 C240G probably damaging Het
Aox1 A G 1: 58,102,624 I1190V probably damaging Het
Apc2 T G 10: 80,314,844 S1911A probably benign Het
Arfgef3 T C 10: 18,652,763 D292G possibly damaging Het
Arhgef4 C A 1: 34,724,259 S865R probably benign Het
Ass1 T A 2: 31,493,148 Y190* probably null Het
B4galnt3 A T 6: 120,210,090 probably null Het
Btnl10 C A 11: 58,920,541 P230Q possibly damaging Het
C3 A G 17: 57,209,489 Y1348H probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cic C A 7: 25,286,840 T1229K probably damaging Het
Clip4 T C 17: 71,837,749 S524P probably damaging Het
Col6a3 A C 1: 90,811,699 I269R probably damaging Het
Dbh C T 2: 27,181,494 T533I possibly damaging Het
Dcaf17 A T 2: 71,060,369 R83* probably null Het
Dnah1 A G 14: 31,262,558 L3923P probably damaging Het
Dnah7a A T 1: 53,631,562 D510E probably benign Het
Dock6 A G 9: 21,841,629 F296S probably damaging Het
Eif4enif1 T C 11: 3,227,455 S341P probably damaging Het
Epb41l1 G T 2: 156,510,817 G461V possibly damaging Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Gm10684 A G 9: 45,110,213 probably benign Het
Gm12185 T C 11: 48,915,404 E320G probably benign Het
Gm14412 G T 2: 177,315,476 H209N probably damaging Het
Gm14412 A C 2: 177,315,837 S88R probably benign Het
Grhl1 T A 12: 24,608,556 L400Q probably damaging Het
Havcr1 T A 11: 46,773,684 Y216* probably null Het
Hephl1 A C 9: 15,074,124 Y745* probably null Het
Hmcn2 T G 2: 31,411,910 probably null Het
Hs3st6 A G 17: 24,758,136 K197E possibly damaging Het
Ifi214 C T 1: 173,529,511 V9I probably benign Het
Jakmip2 T C 18: 43,567,144 T450A probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Macf1 A T 4: 123,457,841 H1634Q possibly damaging Het
Mcpt8 T A 14: 56,083,834 I58F probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Myo10 T A 15: 25,801,222 V1499E probably damaging Het
Myom2 G T 8: 15,081,023 D320Y probably damaging Het
Olfr1220 G A 2: 89,097,544 P128S probably damaging Het
Olfr1395 A C 11: 49,148,274 N6H possibly damaging Het
Olfr458 C T 6: 42,460,426 V198M probably benign Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr74 A T 2: 87,974,059 V202D possibly damaging Het
Olfr740 T A 14: 50,453,838 M262K probably damaging Het
Pabpc4 G T 4: 123,289,068 R166L possibly damaging Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prdm15 G T 16: 97,837,685 D58E probably benign Het
Rgl2 A G 17: 33,932,148 T117A probably benign Het
Rp1 A G 1: 4,348,720 I723T probably damaging Het
Serpina3g A G 12: 104,241,277 E233G probably damaging Het
Skint6 T A 4: 112,891,990 S798C probably benign Het
Slc35f1 T C 10: 53,021,904 L137P possibly damaging Het
Slc6a20a T C 9: 123,656,308 N246S probably damaging Het
Slc7a2 T C 8: 40,916,497 L663S probably benign Het
Slco1a4 A G 6: 141,815,447 probably null Het
Slit2 A G 5: 48,281,988 T41A probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Ssu2 A T 6: 112,384,427 L23M probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
Syne2 A G 12: 76,094,279 probably null Het
Tekt1 T C 11: 72,351,935 T249A probably benign Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Thsd7b C T 1: 129,678,109 P529L probably damaging Het
Tll1 C T 8: 64,025,107 D871N probably damaging Het
Tlr11 A C 14: 50,361,207 I217L probably benign Het
Tmem87b T A 2: 128,831,559 V241D probably damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Vmn1r18 A T 6: 57,390,041 I176N possibly damaging Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vmn2r74 T C 7: 85,952,442 T663A probably benign Het
Vmn2r8 T C 5: 108,797,570 T724A probably benign Het
Wdr11 T C 7: 129,605,230 V289A possibly damaging Het
Zfp62 T A 11: 49,216,220 D379E probably damaging Het
Zfp78 C T 7: 6,378,898 P316S probably damaging Het
Zfyve27 T G 19: 42,171,548 M1R probably null Het
Zkscan8 G A 13: 21,525,155 P191L probably damaging Het
Other mutations in Smc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Smc2 APN 4 52450842 missense probably damaging 1.00
IGL02045:Smc2 APN 4 52462914 missense probably benign 0.01
IGL03013:Smc2 APN 4 52442280 missense probably damaging 1.00
IGL03031:Smc2 APN 4 52449638 missense probably benign 0.35
IGL03246:Smc2 APN 4 52440301 nonsense probably null
R0539:Smc2 UTSW 4 52458558 missense probably benign 0.01
R0782:Smc2 UTSW 4 52469799 missense probably benign 0.30
R2054:Smc2 UTSW 4 52462948 missense probably benign 0.00
R2109:Smc2 UTSW 4 52474987 missense probably benign 0.00
R2318:Smc2 UTSW 4 52446030 missense probably damaging 1.00
R2352:Smc2 UTSW 4 52460266 missense probably benign
R3418:Smc2 UTSW 4 52476850 splice site probably benign
R4003:Smc2 UTSW 4 52462897 missense probably damaging 1.00
R4133:Smc2 UTSW 4 52450947 missense probably damaging 0.99
R4299:Smc2 UTSW 4 52440238 utr 5 prime probably benign
R4547:Smc2 UTSW 4 52467866 missense probably benign 0.09
R4787:Smc2 UTSW 4 52462927 missense probably damaging 0.98
R4816:Smc2 UTSW 4 52451231 missense probably benign 0.00
R4829:Smc2 UTSW 4 52449612 missense probably damaging 0.98
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4951:Smc2 UTSW 4 52462926 missense possibly damaging 0.95
R4963:Smc2 UTSW 4 52450826 missense probably damaging 1.00
R4996:Smc2 UTSW 4 52461042 splice site probably null
R5028:Smc2 UTSW 4 52458447 missense probably damaging 0.96
R5103:Smc2 UTSW 4 52459033 missense probably damaging 1.00
R5159:Smc2 UTSW 4 52460181 missense possibly damaging 0.65
R5387:Smc2 UTSW 4 52475096 missense probably benign 0.16
R5697:Smc2 UTSW 4 52459045 missense probably benign 0.01
R6006:Smc2 UTSW 4 52459024 missense probably benign
R6246:Smc2 UTSW 4 52460289 missense probably damaging 1.00
R6321:Smc2 UTSW 4 52462814 missense probably benign
R6590:Smc2 UTSW 4 52449375 missense probably benign 0.01
R6658:Smc2 UTSW 4 52451322 missense probably benign 0.21
R6690:Smc2 UTSW 4 52449375 missense probably benign 0.01
R7422:Smc2 UTSW 4 52440301 missense probably benign 0.02
R7486:Smc2 UTSW 4 52462861 missense possibly damaging 0.54
R7487:Smc2 UTSW 4 52478448 missense probably damaging 1.00
R7532:Smc2 UTSW 4 52451013 missense probably damaging 1.00
R7556:Smc2 UTSW 4 52457379 missense probably benign 0.03
X0065:Smc2 UTSW 4 52440370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGAGTTCTGAGATTATAGTTTC -3'
(R):5'- TCCAGTGAATCCTAAAGTCATGG -3'

Sequencing Primer
(F):5'- GTGAGGTTCCTCCCTAAA -3'
(R):5'- CAGTGAATCCTAAAGTCATGGTATAG -3'
Posted On2014-06-30