Incidental Mutation 'R1908:Slc7a2'
ID210062
Institutional Source Beutler Lab
Gene Symbol Slc7a2
Ensembl Gene ENSMUSG00000031596
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 2
SynonymsTea, Cat2, Atrc2
MMRRC Submission 039927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1908 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40862396-40922308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40916497 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 663 (L663S)
Ref Sequence ENSEMBL: ENSMUSP00000112848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432]
Predicted Effect probably benign
Transcript: ENSMUST00000057784
AA Change: L646S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: L646S

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 450 1.4e-55 PFAM
Pfam:AA_permease 38 442 9.7e-38 PFAM
transmembrane domain 492 514 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:AA_permease_C 555 605 4.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098816
AA Change: L647S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: L647S

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 451 8.9e-54 PFAM
Pfam:AA_permease 38 443 5.8e-35 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117077
AA Change: L647S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: L647S

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 454 2e-52 PFAM
Pfam:AA_permease 38 440 4.8e-33 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118432
AA Change: L663S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: L663S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AA_permease_2 51 469 5.1e-54 PFAM
Pfam:AA_permease 55 456 5.1e-36 PFAM
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 541 560 N/A INTRINSIC
Pfam:AA_permease_C 572 622 2.5e-28 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,226,575 D292E probably damaging Het
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
Abca8b C A 11: 109,957,098 L852F possibly damaging Het
Abcc6 T C 7: 46,020,134 probably null Het
Alg11 T G 8: 22,065,568 C240G probably damaging Het
Aox1 A G 1: 58,102,624 I1190V probably damaging Het
Apc2 T G 10: 80,314,844 S1911A probably benign Het
Arfgef3 T C 10: 18,652,763 D292G possibly damaging Het
Arhgef4 C A 1: 34,724,259 S865R probably benign Het
Ass1 T A 2: 31,493,148 Y190* probably null Het
B4galnt3 A T 6: 120,210,090 probably null Het
Btnl10 C A 11: 58,920,541 P230Q possibly damaging Het
C3 A G 17: 57,209,489 Y1348H probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cic C A 7: 25,286,840 T1229K probably damaging Het
Clip4 T C 17: 71,837,749 S524P probably damaging Het
Col6a3 A C 1: 90,811,699 I269R probably damaging Het
Dbh C T 2: 27,181,494 T533I possibly damaging Het
Dcaf17 A T 2: 71,060,369 R83* probably null Het
Dnah1 A G 14: 31,262,558 L3923P probably damaging Het
Dnah7a A T 1: 53,631,562 D510E probably benign Het
Dock6 A G 9: 21,841,629 F296S probably damaging Het
Eif4enif1 T C 11: 3,227,455 S341P probably damaging Het
Epb41l1 G T 2: 156,510,817 G461V possibly damaging Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Gm10684 A G 9: 45,110,213 probably benign Het
Gm12185 T C 11: 48,915,404 E320G probably benign Het
Gm14412 G T 2: 177,315,476 H209N probably damaging Het
Gm14412 A C 2: 177,315,837 S88R probably benign Het
Grhl1 T A 12: 24,608,556 L400Q probably damaging Het
Havcr1 T A 11: 46,773,684 Y216* probably null Het
Hephl1 A C 9: 15,074,124 Y745* probably null Het
Hmcn2 T G 2: 31,411,910 probably null Het
Hs3st6 A G 17: 24,758,136 K197E possibly damaging Het
Ifi214 C T 1: 173,529,511 V9I probably benign Het
Jakmip2 T C 18: 43,567,144 T450A probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Macf1 A T 4: 123,457,841 H1634Q possibly damaging Het
Mcpt8 T A 14: 56,083,834 I58F probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Myo10 T A 15: 25,801,222 V1499E probably damaging Het
Myom2 G T 8: 15,081,023 D320Y probably damaging Het
Olfr1220 G A 2: 89,097,544 P128S probably damaging Het
Olfr1395 A C 11: 49,148,274 N6H possibly damaging Het
Olfr458 C T 6: 42,460,426 V198M probably benign Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr74 A T 2: 87,974,059 V202D possibly damaging Het
Olfr740 T A 14: 50,453,838 M262K probably damaging Het
Pabpc4 G T 4: 123,289,068 R166L possibly damaging Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prdm15 G T 16: 97,837,685 D58E probably benign Het
Rgl2 A G 17: 33,932,148 T117A probably benign Het
Rp1 A G 1: 4,348,720 I723T probably damaging Het
Serpina3g A G 12: 104,241,277 E233G probably damaging Het
Skint6 T A 4: 112,891,990 S798C probably benign Het
Slc35f1 T C 10: 53,021,904 L137P possibly damaging Het
Slc6a20a T C 9: 123,656,308 N246S probably damaging Het
Slco1a4 A G 6: 141,815,447 probably null Het
Slit2 A G 5: 48,281,988 T41A probably damaging Het
Smc2 T C 4: 52,450,863 I227T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Ssu2 A T 6: 112,384,427 L23M probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
Syne2 A G 12: 76,094,279 probably null Het
Tekt1 T C 11: 72,351,935 T249A probably benign Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Thsd7b C T 1: 129,678,109 P529L probably damaging Het
Tll1 C T 8: 64,025,107 D871N probably damaging Het
Tlr11 A C 14: 50,361,207 I217L probably benign Het
Tmem87b T A 2: 128,831,559 V241D probably damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Vmn1r18 A T 6: 57,390,041 I176N possibly damaging Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vmn2r74 T C 7: 85,952,442 T663A probably benign Het
Vmn2r8 T C 5: 108,797,570 T724A probably benign Het
Wdr11 T C 7: 129,605,230 V289A possibly damaging Het
Zfp62 T A 11: 49,216,220 D379E probably damaging Het
Zfp78 C T 7: 6,378,898 P316S probably damaging Het
Zfyve27 T G 19: 42,171,548 M1R probably null Het
Zkscan8 G A 13: 21,525,155 P191L probably damaging Het
Other mutations in Slc7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc7a2 APN 8 40905622 missense possibly damaging 0.57
IGL00948:Slc7a2 APN 8 40912524 missense probably benign 0.04
IGL01565:Slc7a2 APN 8 40899238 missense possibly damaging 0.94
IGL01590:Slc7a2 APN 8 40914100 missense probably damaging 1.00
IGL01939:Slc7a2 APN 8 40914083 missense possibly damaging 0.93
IGL02043:Slc7a2 APN 8 40911058 missense probably benign 0.35
IGL02101:Slc7a2 APN 8 40902594 missense probably benign 0.07
IGL02238:Slc7a2 APN 8 40908156 missense probably benign
IGL02385:Slc7a2 APN 8 40899011 missense probably damaging 0.98
IGL02562:Slc7a2 APN 8 40915020 missense probably damaging 1.00
IGL02962:Slc7a2 APN 8 40905584 missense probably damaging 0.98
IGL03268:Slc7a2 APN 8 40912517 missense probably benign 0.00
IGL03285:Slc7a2 APN 8 40914993 missense possibly damaging 0.50
IGL03345:Slc7a2 APN 8 40916493 missense probably benign 0.25
IGL03375:Slc7a2 APN 8 40916373 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0437:Slc7a2 UTSW 8 40904526 missense probably damaging 1.00
R0624:Slc7a2 UTSW 8 40908531 missense probably benign 0.34
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1959:Slc7a2 UTSW 8 40914965 missense probably damaging 0.97
R2251:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2252:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2253:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R3498:Slc7a2 UTSW 8 40912530 missense probably benign 0.11
R3899:Slc7a2 UTSW 8 40905553 missense possibly damaging 0.93
R4440:Slc7a2 UTSW 8 40902649 missense probably benign
R4785:Slc7a2 UTSW 8 40911058 missense probably benign 0.18
R4788:Slc7a2 UTSW 8 40913986 missense probably benign
R4826:Slc7a2 UTSW 8 40911046 missense probably damaging 1.00
R4996:Slc7a2 UTSW 8 40912562 nonsense probably null
R5249:Slc7a2 UTSW 8 40908093 missense possibly damaging 0.77
R5314:Slc7a2 UTSW 8 40915030 critical splice donor site probably null
R5408:Slc7a2 UTSW 8 40915005 missense probably damaging 1.00
R5537:Slc7a2 UTSW 8 40913986 missense probably benign 0.10
R6116:Slc7a2 UTSW 8 40900169 missense probably damaging 0.98
R7139:Slc7a2 UTSW 8 40915013 missense probably benign 0.01
R7389:Slc7a2 UTSW 8 40912515 missense probably benign
R7451:Slc7a2 UTSW 8 40912649 missense probably damaging 0.99
X0062:Slc7a2 UTSW 8 40914963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACACTTGATGCGCTTTC -3'
(R):5'- TAGCTGAGGAGTGCTCTCAG -3'

Sequencing Primer
(F):5'- GATGCGCTTTCTCTCCCCAAAG -3'
(R):5'- CACCATCTGAAGAGAAGCTGTCTG -3'
Posted On2014-06-30