Incidental Mutation 'R1908:Cebpz'
ID210102
Institutional Source Beutler Lab
Gene Symbol Cebpz
Ensembl Gene ENSMUSG00000024081
Gene NameCCAAT/enhancer binding protein zeta
SynonymsCebpa-rs1, Cbf, CBF2
MMRRC Submission 039927-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1908 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78919006-78937070 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 78934907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 439 (Y439*)
Ref Sequence ENSEMBL: ENSMUSP00000024885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024885] [ENSMUST00000024887]
Predicted Effect probably null
Transcript: ENSMUST00000024885
AA Change: Y439*
SMART Domains Protein: ENSMUSP00000024885
Gene: ENSMUSG00000024081
AA Change: Y439*

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
coiled coil region 113 143 N/A INTRINSIC
Pfam:CBF 523 732 5.7e-58 PFAM
low complexity region 834 851 N/A INTRINSIC
low complexity region 881 904 N/A INTRINSIC
low complexity region 957 969 N/A INTRINSIC
low complexity region 1028 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024887
SMART Domains Protein: ENSMUSP00000024887
Gene: ENSMUSG00000024082

DomainStartEndE-ValueType
Pfam:Methyltransf_28 95 349 5.5e-75 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CEBP family. The encoded protein plays a role in cellular response to environmental stimuli through a transcriptional process that involves heat shock factors, conserved DNA elements (heat shock elements or HSEs) and CCAAT boxes. The protein acts as a DNA-binding transcriptional activator and regulates the heat-shock protein 70 (HSP70) promoter in a CCAAT-dependent manner. The protein is also involved in cell growth and differentiation, particularly, hematopoietic differentiation. Methylation of the promoter of this gene or mutations within the gene may be correlated with occurance of acute myeloid leukemia (AML). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G T 14: 49,226,575 D292E probably damaging Het
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
Abca8b C A 11: 109,957,098 L852F possibly damaging Het
Abcc6 T C 7: 46,020,134 probably null Het
Alg11 T G 8: 22,065,568 C240G probably damaging Het
Aox1 A G 1: 58,102,624 I1190V probably damaging Het
Apc2 T G 10: 80,314,844 S1911A probably benign Het
Arfgef3 T C 10: 18,652,763 D292G possibly damaging Het
Arhgef4 C A 1: 34,724,259 S865R probably benign Het
Ass1 T A 2: 31,493,148 Y190* probably null Het
B4galnt3 A T 6: 120,210,090 probably null Het
Btnl10 C A 11: 58,920,541 P230Q possibly damaging Het
C3 A G 17: 57,209,489 Y1348H probably damaging Het
Cic C A 7: 25,286,840 T1229K probably damaging Het
Clip4 T C 17: 71,837,749 S524P probably damaging Het
Col6a3 A C 1: 90,811,699 I269R probably damaging Het
Dbh C T 2: 27,181,494 T533I possibly damaging Het
Dcaf17 A T 2: 71,060,369 R83* probably null Het
Dnah1 A G 14: 31,262,558 L3923P probably damaging Het
Dnah7a A T 1: 53,631,562 D510E probably benign Het
Dock6 A G 9: 21,841,629 F296S probably damaging Het
Eif4enif1 T C 11: 3,227,455 S341P probably damaging Het
Epb41l1 G T 2: 156,510,817 G461V possibly damaging Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Gm10684 A G 9: 45,110,213 probably benign Het
Gm12185 T C 11: 48,915,404 E320G probably benign Het
Gm14412 G T 2: 177,315,476 H209N probably damaging Het
Gm14412 A C 2: 177,315,837 S88R probably benign Het
Grhl1 T A 12: 24,608,556 L400Q probably damaging Het
Havcr1 T A 11: 46,773,684 Y216* probably null Het
Hephl1 A C 9: 15,074,124 Y745* probably null Het
Hmcn2 T G 2: 31,411,910 probably null Het
Hs3st6 A G 17: 24,758,136 K197E possibly damaging Het
Ifi214 C T 1: 173,529,511 V9I probably benign Het
Jakmip2 T C 18: 43,567,144 T450A probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Macf1 A T 4: 123,457,841 H1634Q possibly damaging Het
Mcpt8 T A 14: 56,083,834 I58F probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Myo10 T A 15: 25,801,222 V1499E probably damaging Het
Myom2 G T 8: 15,081,023 D320Y probably damaging Het
Olfr1220 G A 2: 89,097,544 P128S probably damaging Het
Olfr1395 A C 11: 49,148,274 N6H possibly damaging Het
Olfr458 C T 6: 42,460,426 V198M probably benign Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr74 A T 2: 87,974,059 V202D possibly damaging Het
Olfr740 T A 14: 50,453,838 M262K probably damaging Het
Pabpc4 G T 4: 123,289,068 R166L possibly damaging Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prdm15 G T 16: 97,837,685 D58E probably benign Het
Rgl2 A G 17: 33,932,148 T117A probably benign Het
Rp1 A G 1: 4,348,720 I723T probably damaging Het
Serpina3g A G 12: 104,241,277 E233G probably damaging Het
Skint6 T A 4: 112,891,990 S798C probably benign Het
Slc35f1 T C 10: 53,021,904 L137P possibly damaging Het
Slc6a20a T C 9: 123,656,308 N246S probably damaging Het
Slc7a2 T C 8: 40,916,497 L663S probably benign Het
Slco1a4 A G 6: 141,815,447 probably null Het
Slit2 A G 5: 48,281,988 T41A probably damaging Het
Smc2 T C 4: 52,450,863 I227T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Ssu2 A T 6: 112,384,427 L23M probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
Syne2 A G 12: 76,094,279 probably null Het
Tekt1 T C 11: 72,351,935 T249A probably benign Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Thsd7b C T 1: 129,678,109 P529L probably damaging Het
Tll1 C T 8: 64,025,107 D871N probably damaging Het
Tlr11 A C 14: 50,361,207 I217L probably benign Het
Tmem87b T A 2: 128,831,559 V241D probably damaging Het
Tshz2 T A 2: 169,885,545 I218N possibly damaging Het
Vmn1r18 A T 6: 57,390,041 I176N possibly damaging Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vmn2r74 T C 7: 85,952,442 T663A probably benign Het
Vmn2r8 T C 5: 108,797,570 T724A probably benign Het
Wdr11 T C 7: 129,605,230 V289A possibly damaging Het
Zfp62 T A 11: 49,216,220 D379E probably damaging Het
Zfp78 C T 7: 6,378,898 P316S probably damaging Het
Zfyve27 T G 19: 42,171,548 M1R probably null Het
Zkscan8 G A 13: 21,525,155 P191L probably damaging Het
Other mutations in Cebpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Cebpz APN 17 78934830 missense probably damaging 1.00
IGL01558:Cebpz APN 17 78935305 missense probably damaging 1.00
IGL01724:Cebpz APN 17 78935913 missense probably benign 0.01
IGL01938:Cebpz APN 17 78934961 nonsense probably null
IGL02165:Cebpz APN 17 78922169 missense probably damaging 1.00
IGL02397:Cebpz APN 17 78923261 missense possibly damaging 0.63
IGL02455:Cebpz APN 17 78935036 missense probably benign 0.16
IGL02690:Cebpz APN 17 78922557 missense probably damaging 1.00
IGL02698:Cebpz APN 17 78935574 missense probably benign 0.03
IGL02755:Cebpz APN 17 78931330 missense probably damaging 1.00
IGL02827:Cebpz APN 17 78929331 missense probably damaging 1.00
IGL03149:Cebpz APN 17 78922553 missense probably benign 0.01
cedar_hill UTSW 17 78936910 missense possibly damaging 0.87
R0125:Cebpz UTSW 17 78919888 missense possibly damaging 0.95
R0138:Cebpz UTSW 17 78931391 missense probably benign
R0310:Cebpz UTSW 17 78926124 missense probably damaging 1.00
R0436:Cebpz UTSW 17 78935650 missense probably benign 0.00
R0589:Cebpz UTSW 17 78936879 missense probably damaging 1.00
R0828:Cebpz UTSW 17 78925982 missense probably benign 0.04
R1355:Cebpz UTSW 17 78935324 missense probably benign 0.01
R1367:Cebpz UTSW 17 78923313 missense probably benign
R1583:Cebpz UTSW 17 78934752 missense probably damaging 1.00
R1639:Cebpz UTSW 17 78934606 missense possibly damaging 0.49
R1818:Cebpz UTSW 17 78935376 missense probably damaging 1.00
R1885:Cebpz UTSW 17 78932116 missense probably benign 0.00
R1909:Cebpz UTSW 17 78934907 nonsense probably null
R2094:Cebpz UTSW 17 78935554 missense probably benign 0.03
R2314:Cebpz UTSW 17 78920547 critical splice donor site probably null
R2763:Cebpz UTSW 17 78935929 missense probably benign
R2874:Cebpz UTSW 17 78932103 splice site probably benign
R3807:Cebpz UTSW 17 78935418 missense probably damaging 1.00
R4012:Cebpz UTSW 17 78924467 missense probably damaging 0.98
R5344:Cebpz UTSW 17 78926113 missense possibly damaging 0.82
R5394:Cebpz UTSW 17 78922205 missense probably benign 0.34
R5711:Cebpz UTSW 17 78934611 missense probably damaging 1.00
R5902:Cebpz UTSW 17 78925937 missense probably benign 0.20
R6238:Cebpz UTSW 17 78936910 missense possibly damaging 0.87
R6257:Cebpz UTSW 17 78935832 missense probably benign 0.17
R6825:Cebpz UTSW 17 78919963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGTCGTCACCTATCTGGGAG -3'
(R):5'- GAGCTGCTCTGTGATAAACCC -3'

Sequencing Primer
(F):5'- AGTAAGGGTATGCTCTGTTCACCC -3'
(R):5'- CTGCTCTGTGATAAACCCGAGGAG -3'
Posted On2014-06-30