Incidental Mutation 'R1909:Mdn1'
ID210126
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 039928-MU
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R1909 (G1)
Quality Score114
Status Not validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CGGAGGAGGAGGAGGAG to CGGAGGAGGAGGAG at 32760839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably benign
Transcript: ENSMUST00000071642
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125323
Predicted Effect probably benign
Transcript: ENSMUST00000178134
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
9530053A07Rik T C 7: 28,144,348 V887A possibly damaging Het
Aarsd1 A C 11: 101,410,231 probably null Het
Abcc5 A G 16: 20,376,509 probably null Het
Abcc6 T C 7: 46,020,134 probably null Het
Adam15 C A 3: 89,345,330 M317I probably benign Het
Ago3 T C 4: 126,346,737 T111A probably damaging Het
Amz1 G T 5: 140,752,461 S492I probably benign Het
Arid1a T C 4: 133,693,761 N911S unknown Het
Arntl2 A T 6: 146,810,810 E111V probably benign Het
Ascl2 C A 7: 142,968,163 A115S probably damaging Het
Ash1l T C 3: 88,984,528 V1238A probably benign Het
Asxl2 G T 12: 3,474,577 V202F probably damaging Het
Atp10a A T 7: 58,828,712 Q1501L probably benign Het
Avpr1a A T 10: 122,452,208 I374L probably benign Het
Bmx T C X: 164,239,415 H157R probably benign Het
Camk4 T A 18: 33,158,816 probably null Het
Ccdc103 G A 11: 102,882,566 D5N probably benign Het
Ccdc186 A T 19: 56,793,361 N70K probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cfap206 A C 4: 34,722,714 S122R probably benign Het
Cnst T C 1: 179,622,791 S607P probably damaging Het
Col8a2 C A 4: 126,312,133 D645E possibly damaging Het
Cpsf4l A T 11: 113,703,378 probably null Het
Crim1 C T 17: 78,313,127 T332I probably benign Het
Csmd1 A T 8: 15,906,116 Y3364N probably damaging Het
D5Ertd579e A T 5: 36,614,058 S998T probably benign Het
Dab2ip C G 2: 35,718,815 A587G probably damaging Het
Dach1 C T 14: 97,901,393 G486D probably damaging Het
Ddx24 T C 12: 103,409,982 I752V probably damaging Het
Dhx33 A G 11: 70,989,107 V359A probably benign Het
Dip2c A T 13: 9,533,350 T123S probably benign Het
Dync1h1 G A 12: 110,662,629 E4207K probably damaging Het
Eef1b2 G T 1: 63,177,272 D21Y probably damaging Het
Eif3b T C 5: 140,432,937 S462P probably damaging Het
Elmod2 G C 8: 83,316,369 R277G probably benign Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Ercc8 A T 13: 108,175,566 K172* probably null Het
Fat3 T C 9: 15,998,115 N2197S probably benign Het
Fbf1 A G 11: 116,145,992 V972A possibly damaging Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Fzd1 G T 5: 4,757,481 H34N probably benign Het
Galnt17 T A 5: 131,111,838 Y147F probably benign Het
Gdf6 T C 4: 9,859,971 L351P probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm15448 A T 7: 3,822,919 I317N probably benign Het
Gm2381 A T 7: 42,819,928 H257Q probably damaging Het
Gm6904 A T 14: 59,258,613 S17R probably benign Het
Gm9844 T C 7: 24,862,306 I10T possibly damaging Het
Hivep1 A T 13: 42,155,646 K454M probably benign Het
Hmmr T A 11: 40,708,098 E566D probably damaging Het
Hydin T G 8: 110,587,772 V4296G probably damaging Het
Il18r1 T A 1: 40,474,914 D93E probably damaging Het
Iqgap1 T C 7: 80,743,828 D667G probably benign Het
Lama3 T C 18: 12,581,798 I3278T probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Ncoa7 A T 10: 30,689,800 M666K probably damaging Het
Ndnf T G 6: 65,703,313 V192G possibly damaging Het
Nr4a1 T A 15: 101,274,227 I594N probably damaging Het
Olfr1294 T A 2: 111,538,014 I92F probably damaging Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr618 A G 7: 103,597,343 N9S probably benign Het
Olfr635 G A 7: 103,979,790 W199* probably null Het
Olfr698 T C 7: 106,752,995 N131S probably benign Het
Paxbp1 T C 16: 91,044,305 probably benign Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pcsk5 A T 19: 17,433,461 Y1856N probably benign Het
Pde3a T C 6: 141,250,239 V217A probably benign Het
Pirb A T 7: 3,714,588 D674E probably benign Het
Pnisr T A 4: 21,869,517 M335K possibly damaging Het
Pnpla7 T A 2: 24,997,288 M48K possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkca A T 11: 107,939,612 D217E possibly damaging Het
Rac3 A C 11: 120,723,337 I142L probably benign Het
Ralgapb G T 2: 158,444,675 A347S probably damaging Het
Rbm43 G C 2: 51,925,434 S258R possibly damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Rsph10b T C 5: 143,985,491 F409L probably benign Het
Ryr2 A T 13: 11,700,349 L2778M probably damaging Het
Scn1a T C 2: 66,331,352 N284S possibly damaging Het
Scyl2 A T 10: 89,640,905 M786K probably benign Het
Sema4g C A 19: 44,997,622 R301S probably damaging Het
Senp6 A T 9: 80,113,774 E245D possibly damaging Het
Setx T C 2: 29,163,009 V2095A possibly damaging Het
Slc13a2 A T 11: 78,400,142 M412K possibly damaging Het
Slc25a4 T C 8: 46,209,400 N74D probably damaging Het
Slc28a1 T A 7: 81,142,035 F316L probably damaging Het
Slfn8 G A 11: 83,003,621 Q731* probably null Het
Slitrk4 A G X: 64,272,623 I146T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Smyd1 T A 6: 71,239,579 K61N probably benign Het
Sod2 T C 17: 13,015,169 *223R probably null Het
Sp6 G T 11: 97,021,508 A16S probably benign Het
Spata31d1a A C 13: 59,702,695 Y540D probably damaging Het
Spatc1l A G 10: 76,563,917 D91G probably damaging Het
Spg7 A G 8: 123,080,741 T419A probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
St8sia4 A G 1: 95,627,573 I244T probably damaging Het
Tbl2 C T 5: 135,152,991 R27W probably damaging Het
Tmed4 G A 11: 6,274,694 P47L probably damaging Het
Tmtc1 T C 6: 148,444,048 D51G possibly damaging Het
Ttc28 T C 5: 111,284,054 probably null Het
Unc13d A G 11: 116,070,295 F412S probably damaging Het
Unc45b A C 11: 82,926,087 K451T probably damaging Het
Vmn2r16 A G 5: 109,363,987 M687V probably benign Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vps51 A G 19: 6,069,469 V625A probably benign Het
Wapl T A 14: 34,691,912 W244R probably damaging Het
Wdr75 C T 1: 45,823,403 T794I probably benign Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAAATTGAAGAGCCCGG -3'
(R):5'- TAACGGTTAGGAGAGGGTTTTCAAG -3'

Sequencing Primer
(F):5'- CCGGAGCTGGTCAGGATG -3'
(R):5'- TCTTACAAAAGATTCTGCTGGCATG -3'
Posted On2014-06-30