Incidental Mutation 'R1909:Csmd1'
ID210167
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene NameCUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 039928-MU
Accession Numbers

Genbank: NM_053171.2

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R1909 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location15892537-17535586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15906116 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 3364 (Y3364N)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
Predicted Effect probably damaging
Transcript: ENSMUST00000082104
AA Change: Y3364N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: Y3364N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125551
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
9530053A07Rik T C 7: 28,144,348 V887A possibly damaging Het
Aarsd1 A C 11: 101,410,231 probably null Het
Abcc5 A G 16: 20,376,509 probably null Het
Abcc6 T C 7: 46,020,134 probably null Het
Adam15 C A 3: 89,345,330 M317I probably benign Het
Ago3 T C 4: 126,346,737 T111A probably damaging Het
Amz1 G T 5: 140,752,461 S492I probably benign Het
Arid1a T C 4: 133,693,761 N911S unknown Het
Arntl2 A T 6: 146,810,810 E111V probably benign Het
Ascl2 C A 7: 142,968,163 A115S probably damaging Het
Ash1l T C 3: 88,984,528 V1238A probably benign Het
Asxl2 G T 12: 3,474,577 V202F probably damaging Het
Atp10a A T 7: 58,828,712 Q1501L probably benign Het
Avpr1a A T 10: 122,452,208 I374L probably benign Het
Bmx T C X: 164,239,415 H157R probably benign Het
Camk4 T A 18: 33,158,816 probably null Het
Ccdc103 G A 11: 102,882,566 D5N probably benign Het
Ccdc186 A T 19: 56,793,361 N70K probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cfap206 A C 4: 34,722,714 S122R probably benign Het
Cnst T C 1: 179,622,791 S607P probably damaging Het
Col8a2 C A 4: 126,312,133 D645E possibly damaging Het
Cpsf4l A T 11: 113,703,378 probably null Het
Crim1 C T 17: 78,313,127 T332I probably benign Het
D5Ertd579e A T 5: 36,614,058 S998T probably benign Het
Dab2ip C G 2: 35,718,815 A587G probably damaging Het
Dach1 C T 14: 97,901,393 G486D probably damaging Het
Ddx24 T C 12: 103,409,982 I752V probably damaging Het
Dhx33 A G 11: 70,989,107 V359A probably benign Het
Dip2c A T 13: 9,533,350 T123S probably benign Het
Dync1h1 G A 12: 110,662,629 E4207K probably damaging Het
Eef1b2 G T 1: 63,177,272 D21Y probably damaging Het
Eif3b T C 5: 140,432,937 S462P probably damaging Het
Elmod2 G C 8: 83,316,369 R277G probably benign Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Ercc8 A T 13: 108,175,566 K172* probably null Het
Fat3 T C 9: 15,998,115 N2197S probably benign Het
Fbf1 A G 11: 116,145,992 V972A possibly damaging Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Fzd1 G T 5: 4,757,481 H34N probably benign Het
Galnt17 T A 5: 131,111,838 Y147F probably benign Het
Gdf6 T C 4: 9,859,971 L351P probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm15448 A T 7: 3,822,919 I317N probably benign Het
Gm2381 A T 7: 42,819,928 H257Q probably damaging Het
Gm6904 A T 14: 59,258,613 S17R probably benign Het
Gm9844 T C 7: 24,862,306 I10T possibly damaging Het
Hivep1 A T 13: 42,155,646 K454M probably benign Het
Hmmr T A 11: 40,708,098 E566D probably damaging Het
Hydin T G 8: 110,587,772 V4296G probably damaging Het
Il18r1 T A 1: 40,474,914 D93E probably damaging Het
Iqgap1 T C 7: 80,743,828 D667G probably benign Het
Lama3 T C 18: 12,581,798 I3278T probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Ncoa7 A T 10: 30,689,800 M666K probably damaging Het
Ndnf T G 6: 65,703,313 V192G possibly damaging Het
Nr4a1 T A 15: 101,274,227 I594N probably damaging Het
Olfr1294 T A 2: 111,538,014 I92F probably damaging Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr618 A G 7: 103,597,343 N9S probably benign Het
Olfr635 G A 7: 103,979,790 W199* probably null Het
Olfr698 T C 7: 106,752,995 N131S probably benign Het
Paxbp1 T C 16: 91,044,305 probably benign Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pcsk5 A T 19: 17,433,461 Y1856N probably benign Het
Pde3a T C 6: 141,250,239 V217A probably benign Het
Pirb A T 7: 3,714,588 D674E probably benign Het
Pnisr T A 4: 21,869,517 M335K possibly damaging Het
Pnpla7 T A 2: 24,997,288 M48K possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkca A T 11: 107,939,612 D217E possibly damaging Het
Rac3 A C 11: 120,723,337 I142L probably benign Het
Ralgapb G T 2: 158,444,675 A347S probably damaging Het
Rbm43 G C 2: 51,925,434 S258R possibly damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Rsph10b T C 5: 143,985,491 F409L probably benign Het
Ryr2 A T 13: 11,700,349 L2778M probably damaging Het
Scn1a T C 2: 66,331,352 N284S possibly damaging Het
Scyl2 A T 10: 89,640,905 M786K probably benign Het
Sema4g C A 19: 44,997,622 R301S probably damaging Het
Senp6 A T 9: 80,113,774 E245D possibly damaging Het
Setx T C 2: 29,163,009 V2095A possibly damaging Het
Slc13a2 A T 11: 78,400,142 M412K possibly damaging Het
Slc25a4 T C 8: 46,209,400 N74D probably damaging Het
Slc28a1 T A 7: 81,142,035 F316L probably damaging Het
Slfn8 G A 11: 83,003,621 Q731* probably null Het
Slitrk4 A G X: 64,272,623 I146T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Smyd1 T A 6: 71,239,579 K61N probably benign Het
Sod2 T C 17: 13,015,169 *223R probably null Het
Sp6 G T 11: 97,021,508 A16S probably benign Het
Spata31d1a A C 13: 59,702,695 Y540D probably damaging Het
Spatc1l A G 10: 76,563,917 D91G probably damaging Het
Spg7 A G 8: 123,080,741 T419A probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
St8sia4 A G 1: 95,627,573 I244T probably damaging Het
Tbl2 C T 5: 135,152,991 R27W probably damaging Het
Tmed4 G A 11: 6,274,694 P47L probably damaging Het
Tmtc1 T C 6: 148,444,048 D51G possibly damaging Het
Ttc28 T C 5: 111,284,054 probably null Het
Unc13d A G 11: 116,070,295 F412S probably damaging Het
Unc45b A C 11: 82,926,087 K451T probably damaging Het
Vmn2r16 A G 5: 109,363,987 M687V probably benign Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vps51 A G 19: 6,069,469 V625A probably benign Het
Wapl T A 14: 34,691,912 W244R probably damaging Het
Wdr75 C T 1: 45,823,403 T794I probably benign Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16009297 splice site probably benign
IGL00433:Csmd1 APN 8 16231373 missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15921139 missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16189990 missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16071287 missense probably benign 0.00
IGL01012:Csmd1 APN 8 15917341 missense probably benign 0.00
IGL01123:Csmd1 APN 8 17534928 missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15910596 missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16200055 missense probably benign 0.00
IGL01530:Csmd1 APN 8 15903195 missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16288646 nonsense probably null
IGL01814:Csmd1 APN 8 16501375 missense probably damaging 1.00
IGL01889:Csmd1 APN 8 15998857 missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16069001 missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15926594 missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16211759 missense probably null 0.17
IGL02112:Csmd1 APN 8 16081705 missense probably benign 0.18
IGL02161:Csmd1 APN 8 16358412 missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16271606 missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16199893 missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16211870 missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15903275 missense probably benign 0.08
IGL02424:Csmd1 APN 8 16092326 missense probably benign 0.22
IGL02492:Csmd1 APN 8 16002597 missense probably benign 0.13
IGL02507:Csmd1 APN 8 17534976 utr 5 prime probably benign
IGL02513:Csmd1 APN 8 15999869 splice site probably benign
IGL02727:Csmd1 APN 8 16231327 missense probably damaging 1.00
IGL02728:Csmd1 APN 8 15999779 critical splice donor site probably null
IGL02852:Csmd1 APN 8 15895728 missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16223334 missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16271570 missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15910465 missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16028698 missense probably benign
IGL03129:Csmd1 APN 8 15961521 missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16088217 missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16157092 missense probably benign 0.00
IGL03297:Csmd1 APN 8 16009432 nonsense probably null
I2289:Csmd1 UTSW 8 15912381 missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16095501 missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15945127 missense probably damaging 1.00
R0037:Csmd1 UTSW 8 15917248 missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16233051 missense probably damaging 1.00
R0113:Csmd1 UTSW 8 15984849 missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16079942 missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16391824 missense probably benign 0.16
R0166:Csmd1 UTSW 8 16233022 missense probably benign 0.29
R0227:Csmd1 UTSW 8 16391822 missense probably benign 0.05
R0279:Csmd1 UTSW 8 16223235 missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16271602 missense probably damaging 1.00
R0312:Csmd1 UTSW 8 15984760 missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15918330 missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15917270 missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16346638 missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16710514 missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16501393 critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15921759 missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16233101 missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17027323 missense probably damaging 0.97
R0505:Csmd1 UTSW 8 15992758 missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16185344 splice site probably benign
R0511:Csmd1 UTSW 8 15932529 missense possibly damaging 0.80
R0555:Csmd1 UTSW 8 16185273 missense probably benign
R0580:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15918208 missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16226391 missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16069049 missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16000550 missense probably benign 0.03
R0675:Csmd1 UTSW 8 16158131 missense probably benign 0.01
R0763:Csmd1 UTSW 8 17027284 missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15921174 missense probably benign 0.35
R0862:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16710618 missense probably benign 0.29
R0926:Csmd1 UTSW 8 16033576 splice site probably null
R1005:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16358463 splice site probably benign
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16079964 missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16698036 missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16463081 splice site probably null
R1447:Csmd1 UTSW 8 15925306 nonsense probably null
R1450:Csmd1 UTSW 8 15945180 critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16157204 splice site probably benign
R1580:Csmd1 UTSW 8 15925299 missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15900710 missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16081725 missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15918252 missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17216692 missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15932610 missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15917303 missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16157120 nonsense probably null
R1822:Csmd1 UTSW 8 16223326 missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15929101 missense probably damaging 0.99
R1912:Csmd1 UTSW 8 16233998 critical splice donor site probably null
R1993:Csmd1 UTSW 8 16346684 missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15900782 missense probably benign
R2094:Csmd1 UTSW 8 16079978 missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17216733 missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15917392 missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15929088 missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17027339 critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 15992641 missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16190087 missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16211762 missense probably damaging 1.00
R2984:Csmd1 UTSW 8 15953782 missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15917405 missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17027231 missense probably damaging 1.00
R3620:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3621:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3748:Csmd1 UTSW 8 15906071 missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16201986 missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16079922 missense probably benign 0.00
R3945:Csmd1 UTSW 8 15910619 intron probably null
R3980:Csmd1 UTSW 8 15906056 nonsense probably null
R4061:Csmd1 UTSW 8 15945158 missense probably benign 0.00
R4086:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4087:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4089:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15910464 missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16000490 missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15945011 missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15931037 splice site probably null
R4544:Csmd1 UTSW 8 16710636 missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16391797 missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15921908 splice site probably null
R4620:Csmd1 UTSW 8 16002694 critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16697917 missense probably benign 0.00
R4633:Csmd1 UTSW 8 16002620 missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15932511 missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 15998788 nonsense probably null
R4668:Csmd1 UTSW 8 16023891 missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16023891 missense possibly damaging 0.96
R4709:Csmd1 UTSW 8 16710506 critical splice donor site probably null
R4741:Csmd1 UTSW 8 15910447 missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16009369 missense probably benign 0.11
R4793:Csmd1 UTSW 8 16088263 missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16127296 missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15895674 utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16009439 missense probably benign 0.00
R4932:Csmd1 UTSW 8 16023765 missense probably damaging 0.99
R4944:Csmd1 UTSW 8 15998772 missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16199917 missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15910452 missense probably damaging 0.97
R5028:Csmd1 UTSW 8 15989090 missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16196190 missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16199944 missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17216712 missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16710597 missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15910471 missense probably damaging 1.00
R5462:Csmd1 UTSW 8 15961486 missense probably benign 0.12
R5463:Csmd1 UTSW 8 15984860 missense probably benign 0.34
R5497:Csmd1 UTSW 8 16085181 missense probably benign 0.20
R5536:Csmd1 UTSW 8 16288660 missense probably damaging 0.99
R5711:Csmd1 UTSW 8 15953703 missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16185192 nonsense probably null
R5788:Csmd1 UTSW 8 16201966 missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15932471 missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16071416 missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16070352 missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16071353 missense probably benign 0.00
R5998:Csmd1 UTSW 8 15910443 missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16092305 missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16199860 missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16211850 missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16088301 missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15903231 missense probably benign 0.01
R6197:Csmd1 UTSW 8 15926611 missense probably benign 0.32
R6247:Csmd1 UTSW 8 16196235 missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16058674 missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16710642 missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15903212 missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15932492 missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17535004 start gained probably benign
R6447:Csmd1 UTSW 8 15910527 missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15921150 missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16211695 splice site probably null
R6614:Csmd1 UTSW 8 17216787 missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16002626 missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16037246 missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16185327 missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17534913 missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16092395 missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17216789 missense possibly damaging 0.94
X0011:Csmd1 UTSW 8 16196263 missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16185256 missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16037218 missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15915333 missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 15921875 missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16092258 missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 16189978 missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16200058 missense probably damaging 0.97
Z1088:Csmd1 UTSW 8 16346617 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACCATGGTCACTGAGAATTCC -3'
(R):5'- GTGCTCAAGGTCACCTTAGG -3'

Sequencing Primer
(F):5'- CATGGTCACTGAGAATTCCAATAAC -3'
(R):5'- CAAGGTCACCTTAGGCTTTACATGG -3'
Posted On2014-06-30