Incidental Mutation 'R1909:Hydin'
ID210170
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 039928-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R1909 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110587772 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 4296 (V4296G)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably damaging
Transcript: ENSMUST00000043141
AA Change: V4296G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: V4296G

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
9530053A07Rik T C 7: 28,144,348 V887A possibly damaging Het
Aarsd1 A C 11: 101,410,231 probably null Het
Abcc5 A G 16: 20,376,509 probably null Het
Abcc6 T C 7: 46,020,134 probably null Het
Adam15 C A 3: 89,345,330 M317I probably benign Het
Ago3 T C 4: 126,346,737 T111A probably damaging Het
Amz1 G T 5: 140,752,461 S492I probably benign Het
Arid1a T C 4: 133,693,761 N911S unknown Het
Arntl2 A T 6: 146,810,810 E111V probably benign Het
Ascl2 C A 7: 142,968,163 A115S probably damaging Het
Ash1l T C 3: 88,984,528 V1238A probably benign Het
Asxl2 G T 12: 3,474,577 V202F probably damaging Het
Atp10a A T 7: 58,828,712 Q1501L probably benign Het
Avpr1a A T 10: 122,452,208 I374L probably benign Het
Bmx T C X: 164,239,415 H157R probably benign Het
Camk4 T A 18: 33,158,816 probably null Het
Ccdc103 G A 11: 102,882,566 D5N probably benign Het
Ccdc186 A T 19: 56,793,361 N70K probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cfap206 A C 4: 34,722,714 S122R probably benign Het
Cnst T C 1: 179,622,791 S607P probably damaging Het
Col8a2 C A 4: 126,312,133 D645E possibly damaging Het
Cpsf4l A T 11: 113,703,378 probably null Het
Crim1 C T 17: 78,313,127 T332I probably benign Het
Csmd1 A T 8: 15,906,116 Y3364N probably damaging Het
D5Ertd579e A T 5: 36,614,058 S998T probably benign Het
Dab2ip C G 2: 35,718,815 A587G probably damaging Het
Dach1 C T 14: 97,901,393 G486D probably damaging Het
Ddx24 T C 12: 103,409,982 I752V probably damaging Het
Dhx33 A G 11: 70,989,107 V359A probably benign Het
Dip2c A T 13: 9,533,350 T123S probably benign Het
Dync1h1 G A 12: 110,662,629 E4207K probably damaging Het
Eef1b2 G T 1: 63,177,272 D21Y probably damaging Het
Eif3b T C 5: 140,432,937 S462P probably damaging Het
Elmod2 G C 8: 83,316,369 R277G probably benign Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Ercc8 A T 13: 108,175,566 K172* probably null Het
Fat3 T C 9: 15,998,115 N2197S probably benign Het
Fbf1 A G 11: 116,145,992 V972A possibly damaging Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Fzd1 G T 5: 4,757,481 H34N probably benign Het
Galnt17 T A 5: 131,111,838 Y147F probably benign Het
Gdf6 T C 4: 9,859,971 L351P probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm15448 A T 7: 3,822,919 I317N probably benign Het
Gm2381 A T 7: 42,819,928 H257Q probably damaging Het
Gm6904 A T 14: 59,258,613 S17R probably benign Het
Gm9844 T C 7: 24,862,306 I10T possibly damaging Het
Hivep1 A T 13: 42,155,646 K454M probably benign Het
Hmmr T A 11: 40,708,098 E566D probably damaging Het
Il18r1 T A 1: 40,474,914 D93E probably damaging Het
Iqgap1 T C 7: 80,743,828 D667G probably benign Het
Lama3 T C 18: 12,581,798 I3278T probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Ncoa7 A T 10: 30,689,800 M666K probably damaging Het
Ndnf T G 6: 65,703,313 V192G possibly damaging Het
Nr4a1 T A 15: 101,274,227 I594N probably damaging Het
Olfr1294 T A 2: 111,538,014 I92F probably damaging Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr618 A G 7: 103,597,343 N9S probably benign Het
Olfr635 G A 7: 103,979,790 W199* probably null Het
Olfr698 T C 7: 106,752,995 N131S probably benign Het
Paxbp1 T C 16: 91,044,305 probably benign Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pcsk5 A T 19: 17,433,461 Y1856N probably benign Het
Pde3a T C 6: 141,250,239 V217A probably benign Het
Pirb A T 7: 3,714,588 D674E probably benign Het
Pnisr T A 4: 21,869,517 M335K possibly damaging Het
Pnpla7 T A 2: 24,997,288 M48K possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkca A T 11: 107,939,612 D217E possibly damaging Het
Rac3 A C 11: 120,723,337 I142L probably benign Het
Ralgapb G T 2: 158,444,675 A347S probably damaging Het
Rbm43 G C 2: 51,925,434 S258R possibly damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Rsph10b T C 5: 143,985,491 F409L probably benign Het
Ryr2 A T 13: 11,700,349 L2778M probably damaging Het
Scn1a T C 2: 66,331,352 N284S possibly damaging Het
Scyl2 A T 10: 89,640,905 M786K probably benign Het
Sema4g C A 19: 44,997,622 R301S probably damaging Het
Senp6 A T 9: 80,113,774 E245D possibly damaging Het
Setx T C 2: 29,163,009 V2095A possibly damaging Het
Slc13a2 A T 11: 78,400,142 M412K possibly damaging Het
Slc25a4 T C 8: 46,209,400 N74D probably damaging Het
Slc28a1 T A 7: 81,142,035 F316L probably damaging Het
Slfn8 G A 11: 83,003,621 Q731* probably null Het
Slitrk4 A G X: 64,272,623 I146T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Smyd1 T A 6: 71,239,579 K61N probably benign Het
Sod2 T C 17: 13,015,169 *223R probably null Het
Sp6 G T 11: 97,021,508 A16S probably benign Het
Spata31d1a A C 13: 59,702,695 Y540D probably damaging Het
Spatc1l A G 10: 76,563,917 D91G probably damaging Het
Spg7 A G 8: 123,080,741 T419A probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
St8sia4 A G 1: 95,627,573 I244T probably damaging Het
Tbl2 C T 5: 135,152,991 R27W probably damaging Het
Tmed4 G A 11: 6,274,694 P47L probably damaging Het
Tmtc1 T C 6: 148,444,048 D51G possibly damaging Het
Ttc28 T C 5: 111,284,054 probably null Het
Unc13d A G 11: 116,070,295 F412S probably damaging Het
Unc45b A C 11: 82,926,087 K451T probably damaging Het
Vmn2r16 A G 5: 109,363,987 M687V probably benign Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vps51 A G 19: 6,069,469 V625A probably benign Het
Wapl T A 14: 34,691,912 W244R probably damaging Het
Wdr75 C T 1: 45,823,403 T794I probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
franz_joseph UTSW 8 110601318 missense probably damaging 1.00
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCCAATGAATATCTCTCCCTAGAC -3'
(R):5'- ACCTGAGGGCCATTTCCAAG -3'

Sequencing Primer
(F):5'- CAGTTTCATCAACACGGG -3'
(R):5'- AGGCAACCACACTGTTGG -3'
Posted On2014-06-30