Incidental Mutation 'R1909:Spata31d1a'
ID210207
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 039928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1909 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59702695 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 540 (Y540D)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably damaging
Transcript: ENSMUST00000066510
AA Change: Y540D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: Y540D

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably damaging
Transcript: ENSMUST00000224982
AA Change: Y540D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,258,036 I59L probably benign Het
9530053A07Rik T C 7: 28,144,348 V887A possibly damaging Het
Aarsd1 A C 11: 101,410,231 probably null Het
Abcc5 A G 16: 20,376,509 probably null Het
Abcc6 T C 7: 46,020,134 probably null Het
Adam15 C A 3: 89,345,330 M317I probably benign Het
Ago3 T C 4: 126,346,737 T111A probably damaging Het
Amz1 G T 5: 140,752,461 S492I probably benign Het
Arid1a T C 4: 133,693,761 N911S unknown Het
Arntl2 A T 6: 146,810,810 E111V probably benign Het
Ascl2 C A 7: 142,968,163 A115S probably damaging Het
Ash1l T C 3: 88,984,528 V1238A probably benign Het
Asxl2 G T 12: 3,474,577 V202F probably damaging Het
Atp10a A T 7: 58,828,712 Q1501L probably benign Het
Avpr1a A T 10: 122,452,208 I374L probably benign Het
Bmx T C X: 164,239,415 H157R probably benign Het
Camk4 T A 18: 33,158,816 probably null Het
Ccdc103 G A 11: 102,882,566 D5N probably benign Het
Ccdc186 A T 19: 56,793,361 N70K probably damaging Het
Cebpz A T 17: 78,934,907 Y439* probably null Het
Cfap206 A C 4: 34,722,714 S122R probably benign Het
Cnst T C 1: 179,622,791 S607P probably damaging Het
Col8a2 C A 4: 126,312,133 D645E possibly damaging Het
Cpsf4l A T 11: 113,703,378 probably null Het
Crim1 C T 17: 78,313,127 T332I probably benign Het
Csmd1 A T 8: 15,906,116 Y3364N probably damaging Het
D5Ertd579e A T 5: 36,614,058 S998T probably benign Het
Dab2ip C G 2: 35,718,815 A587G probably damaging Het
Dach1 C T 14: 97,901,393 G486D probably damaging Het
Ddx24 T C 12: 103,409,982 I752V probably damaging Het
Dhx33 A G 11: 70,989,107 V359A probably benign Het
Dip2c A T 13: 9,533,350 T123S probably benign Het
Dync1h1 G A 12: 110,662,629 E4207K probably damaging Het
Eef1b2 G T 1: 63,177,272 D21Y probably damaging Het
Eif3b T C 5: 140,432,937 S462P probably damaging Het
Elmod2 G C 8: 83,316,369 R277G probably benign Het
Epg5 T A 18: 77,959,032 D555E probably benign Het
Ercc8 A T 13: 108,175,566 K172* probably null Het
Fat3 T C 9: 15,998,115 N2197S probably benign Het
Fbf1 A G 11: 116,145,992 V972A possibly damaging Het
Fes T C 7: 80,386,861 R113G probably damaging Het
Fzd1 G T 5: 4,757,481 H34N probably benign Het
Galnt17 T A 5: 131,111,838 Y147F probably benign Het
Gdf6 T C 4: 9,859,971 L351P probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm15448 A T 7: 3,822,919 I317N probably benign Het
Gm2381 A T 7: 42,819,928 H257Q probably damaging Het
Gm6904 A T 14: 59,258,613 S17R probably benign Het
Gm9844 T C 7: 24,862,306 I10T possibly damaging Het
Hivep1 A T 13: 42,155,646 K454M probably benign Het
Hmmr T A 11: 40,708,098 E566D probably damaging Het
Hydin T G 8: 110,587,772 V4296G probably damaging Het
Il18r1 T A 1: 40,474,914 D93E probably damaging Het
Iqgap1 T C 7: 80,743,828 D667G probably benign Het
Lama3 T C 18: 12,581,798 I3278T probably benign Het
Lrp4 T A 2: 91,498,408 V1551D possibly damaging Het
Mdn1 CGGAGGAGGAGGAGGAG CGGAGGAGGAGGAG 4: 32,760,839 probably benign Het
Mga T A 2: 119,926,594 H1018Q possibly damaging Het
Ncoa7 A T 10: 30,689,800 M666K probably damaging Het
Ndnf T G 6: 65,703,313 V192G possibly damaging Het
Nr4a1 T A 15: 101,274,227 I594N probably damaging Het
Olfr1294 T A 2: 111,538,014 I92F probably damaging Het
Olfr60 T C 7: 140,345,465 I175V probably benign Het
Olfr618 A G 7: 103,597,343 N9S probably benign Het
Olfr635 G A 7: 103,979,790 W199* probably null Het
Olfr698 T C 7: 106,752,995 N131S probably benign Het
Paxbp1 T C 16: 91,044,305 probably benign Het
Pcdhb8 A G 18: 37,355,962 E231G possibly damaging Het
Pcsk5 A T 19: 17,433,461 Y1856N probably benign Het
Pde3a T C 6: 141,250,239 V217A probably benign Het
Pirb A T 7: 3,714,588 D674E probably benign Het
Pnisr T A 4: 21,869,517 M335K possibly damaging Het
Pnpla7 T A 2: 24,997,288 M48K possibly damaging Het
Pomgnt2 A T 9: 121,982,191 I508N possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkca A T 11: 107,939,612 D217E possibly damaging Het
Rac3 A C 11: 120,723,337 I142L probably benign Het
Ralgapb G T 2: 158,444,675 A347S probably damaging Het
Rbm43 G C 2: 51,925,434 S258R possibly damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Rsph10b T C 5: 143,985,491 F409L probably benign Het
Ryr2 A T 13: 11,700,349 L2778M probably damaging Het
Scn1a T C 2: 66,331,352 N284S possibly damaging Het
Scyl2 A T 10: 89,640,905 M786K probably benign Het
Sema4g C A 19: 44,997,622 R301S probably damaging Het
Senp6 A T 9: 80,113,774 E245D possibly damaging Het
Setx T C 2: 29,163,009 V2095A possibly damaging Het
Slc13a2 A T 11: 78,400,142 M412K possibly damaging Het
Slc25a4 T C 8: 46,209,400 N74D probably damaging Het
Slc28a1 T A 7: 81,142,035 F316L probably damaging Het
Slfn8 G A 11: 83,003,621 Q731* probably null Het
Slitrk4 A G X: 64,272,623 I146T probably damaging Het
Smg1 A G 7: 118,154,199 probably benign Het
Smg8 G T 11: 87,080,613 Y777* probably null Het
Smyd1 T A 6: 71,239,579 K61N probably benign Het
Sod2 T C 17: 13,015,169 *223R probably null Het
Sp6 G T 11: 97,021,508 A16S probably benign Het
Spatc1l A G 10: 76,563,917 D91G probably damaging Het
Spg7 A G 8: 123,080,741 T419A probably benign Het
St5 G A 7: 109,525,326 Q686* probably null Het
St8sia4 A G 1: 95,627,573 I244T probably damaging Het
Tbl2 C T 5: 135,152,991 R27W probably damaging Het
Tmed4 G A 11: 6,274,694 P47L probably damaging Het
Tmtc1 T C 6: 148,444,048 D51G possibly damaging Het
Ttc28 T C 5: 111,284,054 probably null Het
Unc13d A G 11: 116,070,295 F412S probably damaging Het
Unc45b A C 11: 82,926,087 K451T probably damaging Het
Vmn2r16 A G 5: 109,363,987 M687V probably benign Het
Vmn2r68 T A 7: 85,234,052 H164L probably benign Het
Vps51 A G 19: 6,069,469 V625A probably benign Het
Wapl T A 14: 34,691,912 W244R probably damaging Het
Wdr75 C T 1: 45,823,403 T794I probably benign Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 unclassified probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTCGCTGGATGAGTCTC -3'
(R):5'- GTACCTCAGTCTCAGATCATGCC -3'

Sequencing Primer
(F):5'- CGCTGGATGAGTCTCTTTCGAAG -3'
(R):5'- AGTCTCAGATCATGCCTGACTC -3'
Posted On2014-06-30