Incidental Mutation 'R1911:Asph'
ID210247
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Nameaspartate-beta-hydroxylase
Synonymsaspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location9448069-9669344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9453335 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 646 (E646G)
Ref Sequence ENSEMBL: ENSMUSP00000103976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000078139] [ENSMUST00000108339] [ENSMUST00000108340] [ENSMUST00000108348]
Predicted Effect probably benign
Transcript: ENSMUST00000038841
SMART Domains Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078139
AA Change: E729G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: E729G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108339
AA Change: E646G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: E646G

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108340
AA Change: E713G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: E713G

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108348
SMART Domains Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151232
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dmxl1 T C 18: 49,878,163 I1129T probably benign Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9639322 missense probably damaging 1.00
IGL00928:Asph APN 4 9594675 missense probably benign 0.07
IGL01022:Asph APN 4 9601344 missense possibly damaging 0.63
IGL01677:Asph APN 4 9607853 missense probably damaging 1.00
IGL01907:Asph APN 4 9514643 missense possibly damaging 0.59
IGL01958:Asph APN 4 9474904 missense possibly damaging 0.93
IGL01976:Asph APN 4 9475471 missense probably damaging 0.98
IGL01989:Asph APN 4 9602462 splice site probably benign
IGL02379:Asph APN 4 9474980 missense probably damaging 1.00
IGL02444:Asph APN 4 9542319 splice site probably benign
IGL02652:Asph APN 4 9529984 missense probably benign 0.11
IGL02679:Asph APN 4 9601349 missense possibly damaging 0.63
IGL02735:Asph APN 4 9598759 missense probably damaging 1.00
IGL02875:Asph APN 4 9595380 missense probably damaging 1.00
IGL03022:Asph APN 4 9517668 missense possibly damaging 0.48
R0026:Asph UTSW 4 9601361 missense probably damaging 0.97
R0121:Asph UTSW 4 9635918 missense probably damaging 1.00
R0357:Asph UTSW 4 9453314 missense probably benign 0.01
R0410:Asph UTSW 4 9595415 missense probably damaging 1.00
R0554:Asph UTSW 4 9604581 missense probably damaging 0.99
R0577:Asph UTSW 4 9604620 missense probably benign 0.02
R0718:Asph UTSW 4 9514683 splice site probably benign
R0725:Asph UTSW 4 9542275 missense probably damaging 1.00
R1383:Asph UTSW 4 9537807 intron probably null
R1654:Asph UTSW 4 9453315 missense probably benign 0.31
R1694:Asph UTSW 4 9610869 missense probably damaging 0.99
R1771:Asph UTSW 4 9598773 missense probably damaging 0.99
R1776:Asph UTSW 4 9598773 missense probably damaging 0.99
R1840:Asph UTSW 4 9601340 missense possibly damaging 0.60
R1912:Asph UTSW 4 9453335 missense probably damaging 1.00
R2117:Asph UTSW 4 9517671 nonsense probably null
R2860:Asph UTSW 4 9598277 missense probably damaging 1.00
R2861:Asph UTSW 4 9598277 missense probably damaging 1.00
R2937:Asph UTSW 4 9542314 splice site probably benign
R3907:Asph UTSW 4 9474934 missense probably benign 0.23
R4154:Asph UTSW 4 9639250 nonsense probably null
R4623:Asph UTSW 4 9622005 missense possibly damaging 0.50
R4871:Asph UTSW 4 9531968 missense probably benign 0.02
R5196:Asph UTSW 4 9607830 missense probably damaging 0.99
R5540:Asph UTSW 4 9635906 missense probably damaging 1.00
R5757:Asph UTSW 4 9637722 intron probably null
R6063:Asph UTSW 4 9531960 missense probably benign 0.05
R6072:Asph UTSW 4 9643533 critical splice donor site probably null
R7133:Asph UTSW 4 9484575 missense probably benign 0.01
Z1088:Asph UTSW 4 9630715 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATCGCAGGAAGGCAAATGTTC -3'
(R):5'- ATGGACAGAAACTGGTCCTCG -3'

Sequencing Primer
(F):5'- CTCCAGTGAGTTCTAATCCAGAAGG -3'
(R):5'- AGAAACTGGTCCTCGAGCCTG -3'
Posted On2014-06-30