Incidental Mutation 'R0121:Slc2a9'
ID21025
Institutional Source Beutler Lab
Gene Symbol Slc2a9
Ensembl Gene ENSMUSG00000005107
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 9
SynonymsSLC2a9A, Glut9, SLC2A9B
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0121 (G1)
Quality Score166
Status Validated (trace)
Chromosome5
Chromosomal Location38349273-38503143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38398743 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 287 (I287V)
Ref Sequence ENSEMBL: ENSMUSP00000116354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005238] [ENSMUST00000067872] [ENSMUST00000067886] [ENSMUST00000122970] [ENSMUST00000129099] [ENSMUST00000143758] [ENSMUST00000155634] [ENSMUST00000156272]
Predicted Effect probably benign
Transcript: ENSMUST00000005238
SMART Domains Protein: ENSMUSP00000005238
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:MFS_1 20 208 3.5e-10 PFAM
Pfam:Sugar_tr 25 188 1.1e-35 PFAM
Pfam:Sugar_tr 191 373 5.3e-39 PFAM
Pfam:MFS_1 196 397 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067872
AA Change: I287V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066872
Gene: ENSMUSG00000005107
AA Change: I287V

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067886
AA Change: I302V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063352
Gene: ENSMUSG00000005107
AA Change: I302V

DomainStartEndE-ValueType
Pfam:MFS_1 37 344 1.7e-16 PFAM
Pfam:Sugar_tr 40 495 9.8e-107 PFAM
Pfam:MFS_1 328 518 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122970
SMART Domains Protein: ENSMUSP00000117390
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:MFS_1 28 269 7.5e-14 PFAM
Pfam:Sugar_tr 40 260 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129099
AA Change: I287V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122723
Gene: ENSMUSG00000005107
AA Change: I287V

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143758
SMART Domains Protein: ENSMUSP00000118430
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:MFS_1 37 223 4.2e-10 PFAM
Pfam:Sugar_tr 40 203 1.2e-35 PFAM
Pfam:Sugar_tr 206 388 5.8e-39 PFAM
Pfam:MFS_1 209 411 2.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155634
AA Change: I287V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116354
Gene: ENSMUSG00000005107
AA Change: I287V

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156272
SMART Domains Protein: ENSMUSP00000144374
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:Sugar_tr 40 111 4.5e-9 PFAM
transmembrane domain 140 157 N/A INTRINSIC
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC2A facilitative glucose transporter family. Members of this family play a significant role in maintaining glucose homeostasis. The encoded protein may play a role in the development and survival of chondrocytes in cartilage matrices. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial prenatal lethality, polydipsia, hyperuricemia, hyperuricosuria and polyuria, and develop urate nephropathy, characterized by obstructive lithiasis, tubulointerstitial inflammation, cortical fibrosis, renal insufficiency and reduced male weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Slc2a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Slc2a9 APN 5 38436670 missense probably benign 0.19
IGL02505:Slc2a9 APN 5 38436659 missense possibly damaging 0.69
IGL03096:Slc2a9 APN 5 38351229 missense probably damaging 1.00
transporter9 UTSW 5 38382044 missense probably damaging 1.00
R0395:Slc2a9 UTSW 5 38453169 missense probably damaging 1.00
R0599:Slc2a9 UTSW 5 38480144 start gained probably benign
R0610:Slc2a9 UTSW 5 38379942 missense probably damaging 1.00
R0993:Slc2a9 UTSW 5 38382063 missense probably damaging 1.00
R1166:Slc2a9 UTSW 5 38382041 critical splice donor site probably null
R1710:Slc2a9 UTSW 5 38382044 missense probably damaging 1.00
R2256:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R2257:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R4066:Slc2a9 UTSW 5 38483349 missense probably benign 0.03
R4193:Slc2a9 UTSW 5 38398706 missense probably damaging 1.00
R4502:Slc2a9 UTSW 5 38398811 missense probably benign 0.04
R4734:Slc2a9 UTSW 5 38382099 missense probably damaging 1.00
R4917:Slc2a9 UTSW 5 38417260 missense probably benign 0.01
R5218:Slc2a9 UTSW 5 38453181 missense probably damaging 1.00
R5885:Slc2a9 UTSW 5 38440674 missense probably damaging 1.00
R6313:Slc2a9 UTSW 5 38453121 missense probably benign 0.03
R6983:Slc2a9 UTSW 5 38391721 missense probably damaging 1.00
R7173:Slc2a9 UTSW 5 38452871 intron probably null
R7286:Slc2a9 UTSW 5 38453195 missense probably damaging 0.99
R7405:Slc2a9 UTSW 5 38391824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTTGCTGCTGACAGGACAC -3'
(R):5'- GCCCATCCATTCAGGGTCAACATC -3'

Sequencing Primer
(F):5'- ggactgaggacaagccac -3'
(R):5'- CATTCAGGGTCAACATCCTAGATGG -3'
Posted On2013-04-11