Incidental Mutation 'R0121:Psph'
ID21027
Institutional Source Beutler Lab
Gene Symbol Psph
Ensembl Gene ENSMUSG00000029446
Gene Namephosphoserine phosphatase
SynonymsPSPase
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location129765558-129787449 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 129791570 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031399] [ENSMUST00000136507]
Predicted Effect probably benign
Transcript: ENSMUST00000031399
SMART Domains Protein: ENSMUSP00000031399
Gene: ENSMUSG00000029446

DomainStartEndE-ValueType
Pfam:Hydrolase 14 191 5.7e-19 PFAM
Pfam:HAD 17 187 4e-13 PFAM
Pfam:UMPH-1 62 192 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031402
SMART Domains Protein: ENSMUSP00000031402
Gene: ENSMUSG00000029447

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
Pfam:Cpn60_TCP1 30 527 9.9e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083370
Predicted Effect probably benign
Transcript: ENSMUST00000136507
SMART Domains Protein: ENSMUSP00000116292
Gene: ENSMUSG00000029446

DomainStartEndE-ValueType
PDB:1NNL|B 1 59 1e-32 PDB
SCOP:d1j97a_ 15 58 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202854
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a subfamily of the phosphotransferases. This encoded enzyme is responsible for the third and last step in L-serine formation. It catalyzes magnesium-dependent hydrolysis of L-phosphoserine and is also involved in an exchange reaction between L-serine and L-phosphoserine. Deficiency of this protein is thought to be linked to Williams syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Psph
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0539:Psph UTSW 5 129766577 unclassified probably benign
R0650:Psph UTSW 5 129791570 unclassified probably benign
R1236:Psph UTSW 5 129771476 missense probably damaging 1.00
R1474:Psph UTSW 5 129771550 missense probably damaging 1.00
R1844:Psph UTSW 5 129766468 missense probably damaging 1.00
R2130:Psph UTSW 5 129787539 unclassified probably null
R3857:Psph UTSW 5 129771476 missense probably damaging 1.00
R4300:Psph UTSW 5 129787465 unclassified probably null
R4368:Psph UTSW 5 129771590 missense probably benign 0.00
R4738:Psph UTSW 5 129769386 critical splice acceptor site probably null
R5306:Psph UTSW 5 129769367 missense probably damaging 1.00
R5859:Psph UTSW 5 129790621 unclassified probably benign
R6269:Psph UTSW 5 129766465 missense probably damaging 0.99
R7552:Psph UTSW 5 129770736 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTGTCTTGTGTCATAGAGCACTC -3'
(R):5'- GCAAACTCTCAGTTGGCCTCACTC -3'

Sequencing Primer
(F):5'- AGAGCACTCCTTTTTCACATTTGAC -3'
(R):5'- CTTTCGCAAGGGCATCTAAG -3'
Posted On2013-04-11