Incidental Mutation 'R0121:B4galnt3'
ID21031
Institutional Source Beutler Lab
Gene Symbol B4galnt3
Ensembl Gene ENSMUSG00000041372
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 3
Synonyms
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location120203073-120294559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120215038 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 578 (R578H)
Ref Sequence ENSEMBL: ENSMUSP00000148759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057283] [ENSMUST00000212457]
Predicted Effect probably benign
Transcript: ENSMUST00000057283
AA Change: R579H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058253
Gene: ENSMUSG00000041372
AA Change: R579H

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
PA14 129 276 1.16e-21 SMART
low complexity region 591 612 N/A INTRINSIC
Pfam:CHGN 650 985 3.9e-29 PFAM
Pfam:Glyco_transf_7C 896 974 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125341
Predicted Effect probably benign
Transcript: ENSMUST00000212457
AA Change: R578H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in B4galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:B4galnt3 APN 6 120215390 missense possibly damaging 0.87
IGL01543:B4galnt3 APN 6 120209312 missense probably benign 0.00
IGL02692:B4galnt3 APN 6 120210311 missense probably damaging 1.00
IGL03149:B4galnt3 APN 6 120231594 splice site probably benign
IGL03272:B4galnt3 APN 6 120216306 missense probably damaging 1.00
Minimus UTSW 6 120215057 missense probably benign
R0414:B4galnt3 UTSW 6 120216565 missense probably benign 0.05
R1885:B4galnt3 UTSW 6 120223640 missense probably damaging 0.99
R1908:B4galnt3 UTSW 6 120210090 critical splice donor site probably null
R2264:B4galnt3 UTSW 6 120203810 makesense probably null
R4208:B4galnt3 UTSW 6 120215102 missense probably damaging 0.99
R4353:B4galnt3 UTSW 6 120215476 missense possibly damaging 0.89
R4649:B4galnt3 UTSW 6 120224620 missense probably damaging 1.00
R4874:B4galnt3 UTSW 6 120207206 missense probably damaging 1.00
R5046:B4galnt3 UTSW 6 120214798 missense probably damaging 1.00
R5232:B4galnt3 UTSW 6 120232988 missense probably damaging 1.00
R5431:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R5447:B4galnt3 UTSW 6 120215057 missense probably benign
R5458:B4galnt3 UTSW 6 120210385 missense probably damaging 0.98
R5793:B4galnt3 UTSW 6 120208904 critical splice donor site probably null
R5954:B4galnt3 UTSW 6 120225188 missense possibly damaging 0.88
R5985:B4galnt3 UTSW 6 120210158 missense probably damaging 1.00
R6156:B4galnt3 UTSW 6 120214840 missense probably benign 0.02
R6176:B4galnt3 UTSW 6 120224164 missense probably damaging 1.00
R6207:B4galnt3 UTSW 6 120206614 splice site probably null
R6565:B4galnt3 UTSW 6 120217479 nonsense probably null
R7153:B4galnt3 UTSW 6 120214968 missense probably benign 0.00
R7268:B4galnt3 UTSW 6 120215042 missense possibly damaging 0.92
R7307:B4galnt3 UTSW 6 120215431 missense probably benign 0.00
R7311:B4galnt3 UTSW 6 120215435 nonsense probably null
R7360:B4galnt3 UTSW 6 120232979 nonsense probably null
R7538:B4galnt3 UTSW 6 120294423 nonsense probably null
X0028:B4galnt3 UTSW 6 120231552 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCCGATGTGTTACAGTTCAGG -3'
(R):5'- GCCCAGCCGAGATTTGTCTCATTC -3'

Sequencing Primer
(F):5'- GTCGATCCAGTCGGTTCTCAG -3'
(R):5'- GAGATTTGTCTCATTCTGACCAG -3'
Posted On2013-04-11