Incidental Mutation 'R1911:Dmxl1'
ID210323
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
MMRRC Submission 039929-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1911 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49878163 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1129 (I1129T)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: I1129T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: I1129T

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180611
AA Change: I1129T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: I1129T

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.2%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4930590J08Rik T A 6: 91,950,069 probably benign Het
5430419D17Rik T C 7: 131,238,089 V580A probably damaging Het
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Acaa2 A G 18: 74,792,412 E82G probably benign Het
Acap1 T C 11: 69,881,722 D521G probably damaging Het
Adam19 T C 11: 46,121,454 V259A probably damaging Het
Adssl1 T C 12: 112,633,009 V140A probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Ank1 T C 8: 23,099,650 V589A probably damaging Het
Ano2 G A 6: 126,013,691 D803N probably benign Het
Arid1b A G 17: 5,342,966 E2257G probably damaging Het
Asb17 T C 3: 153,844,501 Y57H probably benign Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Aspm T A 1: 139,478,094 I1573K probably benign Het
Bcas1 C A 2: 170,387,943 D236Y probably damaging Het
Bcas2 G T 3: 103,171,797 G9* probably null Het
Btaf1 A G 19: 36,986,630 Q867R probably benign Het
C87499 T C 4: 88,630,072 Q32R possibly damaging Het
Calhm3 C T 19: 47,155,469 V132I possibly damaging Het
Ccer1 A T 10: 97,694,677 I401F possibly damaging Het
Cecr2 T A 6: 120,762,565 probably benign Het
Cep104 G A 4: 154,006,798 R925Q possibly damaging Het
Cep164 T A 9: 45,770,806 M1900L probably benign Het
Crybg1 A G 10: 43,997,677 V1145A possibly damaging Het
Cyp2a4 T A 7: 26,308,974 N180K possibly damaging Het
Dennd4a T C 9: 64,889,086 L798P probably damaging Het
Dnah2 T C 11: 69,515,752 N555D possibly damaging Het
Dock1 T A 7: 134,999,300 M988K probably damaging Het
Elp4 T A 2: 105,702,743 H419L probably damaging Het
Endov T C 11: 119,502,351 V109A possibly damaging Het
Epha8 T C 4: 136,936,314 Y477C probably damaging Het
Erlin1 A G 19: 44,049,122 M188T probably damaging Het
Fam160a1 T A 3: 85,661,218 D998V probably benign Het
Fhod3 A T 18: 25,112,586 D1231V possibly damaging Het
Gimap3 T A 6: 48,765,712 I95F possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Grk1 C A 8: 13,407,923 D274E probably damaging Het
Gsdmc2 G A 15: 63,827,772 A269V probably benign Het
Krt33a T A 11: 100,012,349 Q289L probably benign Het
Krt76 T A 15: 101,888,165 K403* probably null Het
Lcn4 T C 2: 26,670,595 probably benign Het
Mab21l1 T C 3: 55,783,627 S212P possibly damaging Het
Mapk8ip3 A C 17: 24,904,051 D610E probably benign Het
Mastl G T 2: 23,132,680 S677* probably null Het
Mfap3 T C 11: 57,529,736 F181S probably damaging Het
Mlkl T C 8: 111,312,100 probably benign Het
Mov10 G A 3: 104,801,560 probably benign Het
Muc5ac T C 7: 141,796,304 F595L probably benign Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nit2 G A 16: 57,161,683 probably benign Het
Nod1 C T 6: 54,944,440 V298M probably damaging Het
Olfr1216 A G 2: 89,013,221 L281P probably damaging Het
Olfr399 C A 11: 74,054,384 R125L probably damaging Het
Olfr690 T A 7: 105,329,383 I270F probably benign Het
Olfr800 A T 10: 129,660,112 D102V probably benign Het
Olfr834 T C 9: 18,988,900 L304P probably damaging Het
Osbpl5 C A 7: 143,689,925 R864L probably benign Het
Pcnt G A 10: 76,368,816 T2585M possibly damaging Het
Pepd C T 7: 34,934,749 probably benign Het
Pou6f2 T C 13: 18,151,963 I341V probably damaging Het
Prune2 T A 19: 17,113,674 F281I probably benign Het
Psg19 T G 7: 18,794,268 Q183H probably damaging Het
Psme4 T G 11: 30,815,658 S587A probably benign Het
Ptpro T C 6: 137,400,619 probably benign Het
Rasgrp4 T C 7: 29,138,877 V92A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rexo5 C T 7: 119,799,644 A68V probably damaging Het
Robo2 A T 16: 73,958,325 N769K probably damaging Het
Sfrp5 C T 19: 42,198,798 V278I probably benign Het
Sidt1 A G 16: 44,281,871 S309P possibly damaging Het
Slc22a6 A C 19: 8,621,882 Q292H probably benign Het
Slc4a3 G A 1: 75,553,723 R690H probably damaging Het
Snx7 A T 3: 117,829,668 probably null Het
Spag6 T A 2: 18,715,805 Y129* probably null Het
Srcap T C 7: 127,534,822 I905T probably damaging Het
St6gal1 T G 16: 23,321,633 S185A probably damaging Het
Sult6b1 G A 17: 78,888,964 H250Y possibly damaging Het
Tdrd6 T G 17: 43,627,088 N1023T probably benign Het
Tecta C T 9: 42,337,936 E1877K probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tex14 T A 11: 87,495,035 D240E probably damaging Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Thbs2 A G 17: 14,689,842 V165A probably benign Het
Tmem126b T A 7: 90,469,159 Y171F possibly damaging Het
Tpsg1 G T 17: 25,373,400 M46I probably benign Het
Trmt2a A G 16: 18,251,206 K304R probably benign Het
Ttc28 G T 5: 111,280,750 R1845L possibly damaging Het
Umodl1 A T 17: 30,992,154 T884S possibly damaging Het
Vmn2r77 A G 7: 86,811,793 K776E probably damaging Het
Vmn2r88 T C 14: 51,418,214 S627P probably damaging Het
Vrk1 T C 12: 106,057,977 probably null Het
Zfp644 A G 5: 106,635,271 M1079T possibly damaging Het
Znrf1 T C 8: 111,621,601 *41Q probably null Het
Znrf1 T C 8: 111,621,612 F183L possibly damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
hibiscus UTSW 18 49889467 missense probably damaging 1.00
pitcher UTSW 18 49864148 missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49931963 missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49955853 missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49864614 missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49878612 missense probably benign 0.00
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACAAGTCGCTTAGCAGTAGC -3'
(R):5'- TGTCCCAGAGAGGAAATGCC -3'

Sequencing Primer
(F):5'- GCCCACTGGTAATAGTAGATCTCAG -3'
(R):5'- GGAAATGCCTGGTTTTCCTTTCCAG -3'
Posted On2014-06-30