Incidental Mutation 'R1912:Sorl1'
ID210411
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 039930-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R1912 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42081950 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 259 (D259E)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: D259E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D259E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2810474O19Rik T A 6: 149,328,844 D1129E possibly damaging Het
2900092C05Rik A G 7: 12,554,655 M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 I45N possibly damaging Het
9230113P08Rik A T 9: 35,908,619 T23S probably benign Het
Abcb6 A G 1: 75,179,955 V55A probably benign Het
Adam28 A T 14: 68,644,331 D105E probably benign Het
Ahnak T C 19: 9,017,881 S5510P probably damaging Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Alx1 A G 10: 103,025,361 L102P probably damaging Het
Ankrd50 C T 3: 38,456,776 V481I probably benign Het
Aox4 G T 1: 58,264,402 G1200W probably damaging Het
Arhgap45 A C 10: 80,020,690 D24A probably benign Het
Arhgef16 A T 4: 154,280,323 probably null Het
Asic4 A T 1: 75,469,232 Y235F possibly damaging Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Atg4d A G 9: 21,272,639 D350G probably damaging Het
Auts2 T C 5: 131,443,574 T347A probably damaging Het
Bsnd A T 4: 106,488,030 L73* probably null Het
Cachd1 A T 4: 100,953,169 S323C probably damaging Het
Cacna1e A G 1: 154,436,449 I1290T probably damaging Het
Cdh8 T A 8: 99,098,870 N498Y probably damaging Het
Cdkn3 A G 14: 46,769,834 probably null Het
Celf2 A T 2: 6,615,753 M40K probably damaging Het
Cfap57 A C 4: 118,615,010 S57R probably damaging Het
Cfh A G 1: 140,136,141 probably null Het
Chdh A G 14: 30,032,788 S252G probably benign Het
Col8a1 T A 16: 57,627,924 I408F unknown Het
Corin C T 5: 72,358,403 C303Y probably damaging Het
Crlf2 C T 5: 109,557,141 C66Y possibly damaging Het
Csmd1 C T 8: 16,233,998 probably null Het
Cyp4f16 T C 17: 32,545,044 V270A probably damaging Het
Defa29 T A 8: 21,326,012 H113L possibly damaging Het
Dhx35 A T 2: 158,842,307 N501Y probably damaging Het
Dst A G 1: 34,291,850 R4690G probably damaging Het
Elac2 T A 11: 64,994,263 D439E probably benign Het
Ercc6 A G 14: 32,576,803 R1383G probably damaging Het
Fam69b A G 2: 26,632,704 E55G probably damaging Het
Fat3 T A 9: 15,969,988 Y3196F probably damaging Het
Fbxw13 A T 9: 109,181,543 D342E probably benign Het
Fmod A G 1: 134,040,720 N166S possibly damaging Het
Folh1 A G 7: 86,762,967 S199P possibly damaging Het
Fv1 A G 4: 147,869,778 N267S possibly damaging Het
Fyn T C 10: 39,526,832 V200A possibly damaging Het
Ggnbp2 T C 11: 84,862,296 N39S probably benign Het
Gm10509 A T 17: 21,690,924 I53F possibly damaging Het
Gpr139 A T 7: 119,144,879 I161N possibly damaging Het
Grhl2 C T 15: 37,358,407 T148I probably damaging Het
Hmcn1 C A 1: 150,604,882 M4514I probably benign Het
Igsf10 T G 3: 59,329,572 T1063P probably benign Het
Itgav A G 2: 83,795,486 Y792C possibly damaging Het
Itgb2l T C 16: 96,426,935 Q456R probably benign Het
Jph4 G A 14: 55,108,361 A613V probably benign Het
Kcna2 A G 3: 107,105,401 T433A probably benign Het
Kmt2e A G 5: 23,492,395 K97R probably benign Het
Krba1 C A 6: 48,415,765 A871E probably benign Het
Loxhd1 T C 18: 77,340,137 F468L probably benign Het
Lpin1 A G 12: 16,546,727 V713A probably damaging Het
Ltbp2 T A 12: 84,785,863 I67F probably damaging Het
Mdc1 G A 17: 35,844,538 R35H probably benign Het
Mdc1 A G 17: 35,850,811 D872G probably benign Het
Mgam C T 6: 40,764,185 Q959* probably null Het
Mttp T A 3: 138,116,027 T260S probably benign Het
Naalad2 A T 9: 18,376,535 D266E probably benign Het
Nans T A 4: 46,500,162 L182H probably damaging Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nfix A T 8: 84,721,677 V407E probably damaging Het
Nktr T A 9: 121,750,240 probably benign Het
Nlrp10 G A 7: 108,925,395 R293* probably null Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1126 T C 2: 87,457,383 S73P probably damaging Het
Olfr212 A G 6: 116,515,989 T71A probably benign Het
Olfr380 A T 11: 73,453,994 F73I probably damaging Het
Olfr402 T C 11: 74,155,885 C244R probably damaging Het
Olfr452 T C 6: 42,790,477 I146T probably benign Het
Olfr493 A G 7: 108,346,807 L58P probably damaging Het
Olfr749 G A 14: 50,736,778 P128L probably damaging Het
Olfr994 T A 2: 85,430,260 N190Y probably damaging Het
Oxld1 A G 11: 120,456,906 V155A probably damaging Het
Pamr1 T A 2: 102,642,300 F648Y probably damaging Het
Parg T C 14: 32,210,540 W446R probably damaging Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Phf7 T C 14: 31,240,324 I175V possibly damaging Het
Pibf1 G A 14: 99,187,809 probably null Het
Plcxd1 A G 5: 110,103,442 I295V probably benign Het
Pole2 A C 12: 69,209,990 Y254D probably damaging Het
Ppm1e T A 11: 87,244,370 I225F probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnase2b T G 14: 51,162,900 V146G probably damaging Het
Rnf169 G A 7: 99,926,254 T378I probably damaging Het
Rpf2 A G 10: 40,236,201 F80L probably benign Het
Sec11c T A 18: 65,814,874 D128E probably damaging Het
Sept12 A G 16: 4,988,553 V248A probably damaging Het
Serinc1 T C 10: 57,525,451 N82S probably benign Het
Serpina9 A C 12: 104,001,249 W296G probably damaging Het
Sgo2b A C 8: 63,931,469 D164E probably damaging Het
Slc15a3 A G 19: 10,848,613 N223D probably damaging Het
Slc44a3 A G 3: 121,532,166 Y12H probably benign Het
Slco3a1 A G 7: 74,504,611 F42S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx7 A T 3: 117,829,668 probably null Het
Stpg2 G A 3: 139,522,981 probably null Het
Strn T A 17: 78,684,395 Y165F probably damaging Het
Sval2 T A 6: 41,864,320 *106R probably null Het
Tcaf3 A G 6: 42,596,688 S197P possibly damaging Het
Tespa1 C A 10: 130,354,723 T73N probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Thoc5 C A 11: 4,915,561 T380K probably benign Het
Tmprss7 T A 16: 45,656,548 R784* probably null Het
Trank1 A T 9: 111,390,709 L2171F probably benign Het
Trpm2 T G 10: 77,945,876 K303T probably benign Het
Tsta3 A T 15: 75,925,649 D278E possibly damaging Het
Unc80 G A 1: 66,510,625 V681M probably damaging Het
Usp40 A G 1: 87,946,646 F1131L probably benign Het
Vmn1r215 A T 13: 23,076,503 I238F possibly damaging Het
Vwa3a A T 7: 120,795,627 Y890F probably damaging Het
Zdhhc18 A G 4: 133,613,860 L234P probably damaging Het
Zfp109 A G 7: 24,228,251 S578P probably damaging Het
Zfp704 T C 3: 9,609,358 D121G unknown Het
Zgrf1 G T 3: 127,563,137 V671L probably benign Het
Zkscan8 A T 13: 21,520,757 C265* probably null Het
Zscan26 T C 13: 21,445,140 I398V possibly damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTTACCACCACCTTTGTAGC -3'
(R):5'- GTCTTGGAAACAGCCACAGC -3'

Sequencing Primer
(F):5'- GCAAACATATACTTGTCGCGAAG -3'
(R):5'- AAGTGGCAGATCCCCAATTTCTG -3'
Posted On2014-06-30