Incidental Mutation 'R1912:Trank1'
ID210413
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 039930-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1912 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111390709 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 2171 (L2171F)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: L2171F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: L2171F

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198890
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2810474O19Rik T A 6: 149,328,844 D1129E possibly damaging Het
2900092C05Rik A G 7: 12,554,655 M132V probably benign Het
4921524L21Rik T A 18: 6,620,205 I45N possibly damaging Het
9230113P08Rik A T 9: 35,908,619 T23S probably benign Het
Abcb6 A G 1: 75,179,955 V55A probably benign Het
Adam28 A T 14: 68,644,331 D105E probably benign Het
Ahnak T C 19: 9,017,881 S5510P probably damaging Het
Aldh3b1 T G 19: 3,921,187 D159A probably damaging Het
Alx1 A G 10: 103,025,361 L102P probably damaging Het
Ankrd50 C T 3: 38,456,776 V481I probably benign Het
Aox4 G T 1: 58,264,402 G1200W probably damaging Het
Arhgap45 A C 10: 80,020,690 D24A probably benign Het
Arhgef16 A T 4: 154,280,323 probably null Het
Asic4 A T 1: 75,469,232 Y235F possibly damaging Het
Asph T C 4: 9,453,335 E646G probably damaging Het
Atg4d A G 9: 21,272,639 D350G probably damaging Het
Auts2 T C 5: 131,443,574 T347A probably damaging Het
Bsnd A T 4: 106,488,030 L73* probably null Het
Cachd1 A T 4: 100,953,169 S323C probably damaging Het
Cacna1e A G 1: 154,436,449 I1290T probably damaging Het
Cdh8 T A 8: 99,098,870 N498Y probably damaging Het
Cdkn3 A G 14: 46,769,834 probably null Het
Celf2 A T 2: 6,615,753 M40K probably damaging Het
Cfap57 A C 4: 118,615,010 S57R probably damaging Het
Cfh A G 1: 140,136,141 probably null Het
Chdh A G 14: 30,032,788 S252G probably benign Het
Col8a1 T A 16: 57,627,924 I408F unknown Het
Corin C T 5: 72,358,403 C303Y probably damaging Het
Crlf2 C T 5: 109,557,141 C66Y possibly damaging Het
Csmd1 C T 8: 16,233,998 probably null Het
Cyp4f16 T C 17: 32,545,044 V270A probably damaging Het
Defa29 T A 8: 21,326,012 H113L possibly damaging Het
Dhx35 A T 2: 158,842,307 N501Y probably damaging Het
Dst A G 1: 34,291,850 R4690G probably damaging Het
Elac2 T A 11: 64,994,263 D439E probably benign Het
Ercc6 A G 14: 32,576,803 R1383G probably damaging Het
Fam69b A G 2: 26,632,704 E55G probably damaging Het
Fat3 T A 9: 15,969,988 Y3196F probably damaging Het
Fbxw13 A T 9: 109,181,543 D342E probably benign Het
Fmod A G 1: 134,040,720 N166S possibly damaging Het
Folh1 A G 7: 86,762,967 S199P possibly damaging Het
Fv1 A G 4: 147,869,778 N267S possibly damaging Het
Fyn T C 10: 39,526,832 V200A possibly damaging Het
Ggnbp2 T C 11: 84,862,296 N39S probably benign Het
Gm10509 A T 17: 21,690,924 I53F possibly damaging Het
Gpr139 A T 7: 119,144,879 I161N possibly damaging Het
Grhl2 C T 15: 37,358,407 T148I probably damaging Het
Hmcn1 C A 1: 150,604,882 M4514I probably benign Het
Igsf10 T G 3: 59,329,572 T1063P probably benign Het
Itgav A G 2: 83,795,486 Y792C possibly damaging Het
Itgb2l T C 16: 96,426,935 Q456R probably benign Het
Jph4 G A 14: 55,108,361 A613V probably benign Het
Kcna2 A G 3: 107,105,401 T433A probably benign Het
Kmt2e A G 5: 23,492,395 K97R probably benign Het
Krba1 C A 6: 48,415,765 A871E probably benign Het
Loxhd1 T C 18: 77,340,137 F468L probably benign Het
Lpin1 A G 12: 16,546,727 V713A probably damaging Het
Ltbp2 T A 12: 84,785,863 I67F probably damaging Het
Mdc1 G A 17: 35,844,538 R35H probably benign Het
Mdc1 A G 17: 35,850,811 D872G probably benign Het
Mgam C T 6: 40,764,185 Q959* probably null Het
Mttp T A 3: 138,116,027 T260S probably benign Het
Naalad2 A T 9: 18,376,535 D266E probably benign Het
Nans T A 4: 46,500,162 L182H probably damaging Het
Nbas T A 12: 13,566,144 C2228S probably benign Het
Nfix A T 8: 84,721,677 V407E probably damaging Het
Nktr T A 9: 121,750,240 probably benign Het
Nlrp10 G A 7: 108,925,395 R293* probably null Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1126 T C 2: 87,457,383 S73P probably damaging Het
Olfr212 A G 6: 116,515,989 T71A probably benign Het
Olfr380 A T 11: 73,453,994 F73I probably damaging Het
Olfr402 T C 11: 74,155,885 C244R probably damaging Het
Olfr452 T C 6: 42,790,477 I146T probably benign Het
Olfr493 A G 7: 108,346,807 L58P probably damaging Het
Olfr749 G A 14: 50,736,778 P128L probably damaging Het
Olfr994 T A 2: 85,430,260 N190Y probably damaging Het
Oxld1 A G 11: 120,456,906 V155A probably damaging Het
Pamr1 T A 2: 102,642,300 F648Y probably damaging Het
Parg T C 14: 32,210,540 W446R probably damaging Het
Phf3 A T 1: 30,804,345 H1844Q probably damaging Het
Phf7 T C 14: 31,240,324 I175V possibly damaging Het
Pibf1 G A 14: 99,187,809 probably null Het
Plcxd1 A G 5: 110,103,442 I295V probably benign Het
Pole2 A C 12: 69,209,990 Y254D probably damaging Het
Ppm1e T A 11: 87,244,370 I225F probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rnase2b T G 14: 51,162,900 V146G probably damaging Het
Rnf169 G A 7: 99,926,254 T378I probably damaging Het
Rpf2 A G 10: 40,236,201 F80L probably benign Het
Sec11c T A 18: 65,814,874 D128E probably damaging Het
Sept12 A G 16: 4,988,553 V248A probably damaging Het
Serinc1 T C 10: 57,525,451 N82S probably benign Het
Serpina9 A C 12: 104,001,249 W296G probably damaging Het
Sgo2b A C 8: 63,931,469 D164E probably damaging Het
Slc15a3 A G 19: 10,848,613 N223D probably damaging Het
Slc44a3 A G 3: 121,532,166 Y12H probably benign Het
Slco3a1 A G 7: 74,504,611 F42S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx7 A T 3: 117,829,668 probably null Het
Sorl1 A T 9: 42,081,950 D259E probably damaging Het
Stpg2 G A 3: 139,522,981 probably null Het
Strn T A 17: 78,684,395 Y165F probably damaging Het
Sval2 T A 6: 41,864,320 *106R probably null Het
Tcaf3 A G 6: 42,596,688 S197P possibly damaging Het
Tespa1 C A 10: 130,354,723 T73N probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Thoc5 C A 11: 4,915,561 T380K probably benign Het
Tmprss7 T A 16: 45,656,548 R784* probably null Het
Trpm2 T G 10: 77,945,876 K303T probably benign Het
Tsta3 A T 15: 75,925,649 D278E possibly damaging Het
Unc80 G A 1: 66,510,625 V681M probably damaging Het
Usp40 A G 1: 87,946,646 F1131L probably benign Het
Vmn1r215 A T 13: 23,076,503 I238F possibly damaging Het
Vwa3a A T 7: 120,795,627 Y890F probably damaging Het
Zdhhc18 A G 4: 133,613,860 L234P probably damaging Het
Zfp109 A G 7: 24,228,251 S578P probably damaging Het
Zfp704 T C 3: 9,609,358 D121G unknown Het
Zgrf1 G T 3: 127,563,137 V671L probably benign Het
Zkscan8 A T 13: 21,520,757 C265* probably null Het
Zscan26 T C 13: 21,445,140 I398V possibly damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCATCAGAAGGTCCTGG -3'
(R):5'- GTGGAAATCTTCACACTGCTC -3'

Sequencing Primer
(F):5'- ATCAGAAGGTCCTGGCGCTG -3'
(R):5'- GGAAATCTTCACACTGCTCATCCTC -3'
Posted On2014-06-30