Incidental Mutation 'R0121:Tcf21'
ID21044
Institutional Source Beutler Lab
Gene Symbol Tcf21
Ensembl Gene ENSMUSG00000045680
Gene Nametranscription factor 21
Synonymscapsulin, bHLHa23, epc, Pod-1, epicardin, podocyte-expressed 1, Pod1
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0121 (G1)
Quality Score197
Status Validated (trace)
Chromosome10
Chromosomal Location22817281-22820174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22819807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000151767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049930] [ENSMUST00000218002]
Predicted Effect probably benign
Transcript: ENSMUST00000049930
AA Change: T33A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053178
Gene: ENSMUSG00000045680
AA Change: T33A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
HLH 85 137 3.3e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218002
AA Change: T33A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220000
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TCF21 encodes a transcription factor of the basic helix-loop-helix family. The TCF21 product is mesoderm specific, and expressed in embryonic epicardium, mesenchyme-derived tissues of lung, gut, gonad, and both mesenchymal and glomerular epithelial cells in the kidney. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit hypoplastic lungs and kidneys with abnormal vasculature of these organs and the hemopericardium, and die at birth due to respiratory failure. Homozygotes for some mutations are also asplenic. Some alleles cause sex reversal in XY mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Tcf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tcf21 APN 10 22817810 missense possibly damaging 0.82
R0972:Tcf21 UTSW 10 22819722 missense probably benign 0.10
R1276:Tcf21 UTSW 10 22819590 missense probably damaging 1.00
R5109:Tcf21 UTSW 10 22819659 missense probably damaging 0.98
R6125:Tcf21 UTSW 10 22819766 missense probably benign
R6898:Tcf21 UTSW 10 22819504 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATTTAACGAGTCACGCTCTCGCCC -3'
(R):5'- GGCAGCTCCAAACTTTTGAGACCC -3'

Sequencing Primer
(F):5'- CAGGATCTGCCTTAAGTGAGC -3'
(R):5'- AAACTTTTGAGACCCTTTCGTTTCC -3'
Posted On2013-04-11