Incidental Mutation 'R0121:L3mbtl3'
ID21045
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26313870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 499 (D499N)
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: D499N
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: D499N

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: D474N
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: D474N

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: D499N
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: D499N

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218909
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
R7490:L3mbtl3 UTSW 10 26339231 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCACTTTGCATAGTCC -3'
(R):5'- GTTTCCTCTGAGTGTTAAGCCCACC -3'

Sequencing Primer
(F):5'- CACTTTGCATAGTCCTTTGATTTTAC -3'
(R):5'- AAGTGTCACTCACTGCTAGG -3'
Posted On2013-04-11