Incidental Mutation 'R1869:Adgrb3'
ID210470
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 039891-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R1869 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25826438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 108 (I108K)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041838
AA Change: I108K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: I108K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135518
AA Change: I108K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: I108K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146592
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151309
AA Change: I108K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: I108K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195754
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik A G 11: 3,890,067 L110P probably damaging Het
6030458C11Rik T C 15: 12,817,907 D168G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abhd11 A G 5: 135,011,617 Y168C probably damaging Het
Actr5 A C 2: 158,638,723 T554P probably damaging Het
Adamts16 A G 13: 70,735,747 L1103P probably damaging Het
Agbl4 T A 4: 111,566,629 M284K possibly damaging Het
Aoc3 T A 11: 101,331,467 Y176* probably null Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Ap4b1 T A 3: 103,820,868 Y399* probably null Het
Arhgef5 A T 6: 43,288,682 I1553F probably damaging Het
Bag6 T C 17: 35,142,826 V541A probably benign Het
Bdp1 A C 13: 100,042,201 V1879G probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Bsnd C T 4: 106,486,636 V158I probably benign Het
Cachd1 C A 4: 100,983,390 H880N probably damaging Het
Ccdc27 T C 4: 154,026,763 probably null Het
Cd74 C T 18: 60,810,412 P190S probably benign Het
Cep68 A T 11: 20,240,217 L265Q probably damaging Het
Cfap70 G A 14: 20,408,610 Q772* probably null Het
CK137956 T A 4: 127,970,534 S101C possibly damaging Het
Clca3a2 G A 3: 144,806,403 T524M probably benign Het
Cxcr6 T C 9: 123,809,957 S15P probably benign Het
Cyfip2 T A 11: 46,224,168 Y904F probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Ddx56 C T 11: 6,263,993 V389M possibly damaging Het
Dmp1 A T 5: 104,212,076 D206V probably damaging Het
Dnah17 A T 11: 118,047,189 C3350* probably null Het
Dpcr1 A G 17: 35,638,413 L98P possibly damaging Het
Dst A T 1: 34,252,832 S877C probably damaging Het
Ermp1 A G 19: 29,646,015 S192P possibly damaging Het
F13b G A 1: 139,510,934 D359N probably benign Het
Fam171a1 A T 2: 3,226,152 Q769L possibly damaging Het
Fap T C 2: 62,528,727 R411G probably damaging Het
Fbn1 A G 2: 125,352,027 V1340A probably benign Het
Fbxw19 T C 9: 109,482,032 I370V probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Frem2 T G 3: 53,535,196 D2640A probably benign Het
Fzd4 T C 7: 89,407,246 V167A probably benign Het
Galnt3 T C 2: 66,097,779 I258V possibly damaging Het
Galr2 T C 11: 116,283,243 V233A possibly damaging Het
Gldc G T 19: 30,139,332 Q407K probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr89 A G 3: 96,875,659 I325T probably benign Het
Grap T A 11: 61,664,189 Y61N possibly damaging Het
Hbs1l G T 10: 21,358,406 probably null Het
Hexb T A 13: 97,191,259 E134D probably benign Het
Hydin T A 8: 110,500,705 V1507D possibly damaging Het
Igkv8-16 C A 6: 70,386,987 G17V probably benign Het
Kdm4a T A 4: 118,138,871 Q987L probably null Het
Krt76 A G 15: 101,889,487 probably null Het
Lap3 T C 5: 45,503,387 S238P probably benign Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Lipn A G 19: 34,080,739 T287A possibly damaging Het
Macf1 T C 4: 123,351,128 S466G probably damaging Het
Map3k5 C A 10: 20,132,109 S1220* probably null Het
Map4 T C 9: 110,034,964 V419A probably benign Het
Map4 T A 9: 110,068,928 S754R possibly damaging Het
Mroh9 A G 1: 163,026,513 S773P probably damaging Het
Mtus1 A C 8: 41,076,230 probably null Het
Muc1 C T 3: 89,231,810 P533S probably damaging Het
Muc13 A T 16: 33,804,600 I282F probably damaging Het
Myh14 T A 7: 44,611,643 Q1816L possibly damaging Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfml2b A G 1: 170,669,243 D481G probably damaging Het
Olfr1000 A G 2: 85,608,500 S137P probably benign Het
Olfr1087 T A 2: 86,690,391 I195F probably damaging Het
Olfr309 T A 7: 86,306,667 I149F possibly damaging Het
Olfr703 T G 7: 106,845,094 I161S probably benign Het
Olfr884 T A 9: 38,048,202 probably null Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pcnt T C 10: 76,379,906 E2347G probably null Het
Phax T A 18: 56,573,104 V22D probably benign Het
Pik3ca T C 3: 32,450,350 F667S probably damaging Het
Pkd1 T C 17: 24,594,931 F4123S probably damaging Het
Pkhd1 A G 1: 20,615,267 probably null Het
Plcb1 G A 2: 135,311,014 R368K probably benign Het
Prrc2a G T 17: 35,153,308 R1739S possibly damaging Het
Psg23 A T 7: 18,614,618 M88K probably benign Het
Pstk T A 7: 131,387,797 Y354N probably damaging Het
Rab39 A G 9: 53,705,931 I62T possibly damaging Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rasgrp1 T C 2: 117,290,347 Y431C probably damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf167 T A 11: 70,650,139 I197N possibly damaging Het
Rtn1 A G 12: 72,308,168 S335P probably damaging Het
Ryr2 G T 13: 11,662,075 R3297S probably damaging Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scgb1b24 T C 7: 33,744,044 Y43H probably damaging Het
Sh3rf3 T A 10: 59,083,513 M484K probably damaging Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc1a7 A G 4: 108,008,364 T350A probably damaging Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slk T C 19: 47,625,452 F916L probably damaging Het
Snap91 T A 9: 86,790,141 probably null Het
Snrpb2 A T 2: 143,065,186 R25S possibly damaging Het
Specc1l T C 10: 75,261,825 Y811H probably damaging Het
Sprr2h A G 3: 92,386,618 probably benign Het
Sult2a5 A T 7: 13,624,120 I26F probably benign Het
Syt13 C T 2: 92,946,103 T245I possibly damaging Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Telo2 T A 17: 25,114,994 D93V probably benign Het
Tet2 A T 3: 133,481,441 probably null Het
Tgm7 A T 2: 121,101,089 C198S probably damaging Het
Ticrr T C 7: 79,679,135 F674S probably damaging Het
Tmem129 C A 5: 33,654,499 C31F probably damaging Het
Tmem132a T A 19: 10,858,688 D826V possibly damaging Het
Tpd52 T C 3: 8,953,802 probably null Het
Trub2 A G 2: 29,777,666 S321P probably benign Het
Ttc29 A G 8: 78,282,385 T295A probably benign Het
Tubb1 G A 2: 174,456,689 S89N probably benign Het
Ubap2 C A 4: 41,233,617 G91V probably damaging Het
Ugt2b35 A G 5: 87,001,288 N133D probably damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn1r220 A C 13: 23,184,287 C80G probably damaging Het
Vmn1r79 A G 7: 12,176,647 E152G probably benign Het
Vmn2r28 T C 7: 5,486,346 Y498C probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Zcchc11 T A 4: 108,529,300 F1122L probably damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zfp972 A G 2: 177,921,687 probably null Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCAACCAAACTGGCTC -3'
(R):5'- GTGAAGGGAGTCATTTATGGATCC -3'

Sequencing Primer
(F):5'- AAACTGGCTCGGGCTCAC -3'
(R):5'- AGGGAGTCATTTATGGATCCTATTC -3'
Posted On2014-06-30