Incidental Mutation 'R0121:Gabra6'
ID21048
Institutional Source Beutler Lab
Gene Symbol Gabra6
Ensembl Gene ENSMUSG00000020428
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 6
SynonymsGabra-6, alpha6, GABA-ARalpha6
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location42306437-42321072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42314971 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 353 (S353P)
Ref Sequence ENSEMBL: ENSMUSP00000126114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020703] [ENSMUST00000109286] [ENSMUST00000155218]
Predicted Effect probably benign
Transcript: ENSMUST00000020703
AA Change: S343P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020703
Gene: ENSMUSG00000020428
AA Change: S343P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 230 2.4e-43 PFAM
Pfam:Neur_chan_memb 237 378 9.3e-43 PFAM
transmembrane domain 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109286
AA Change: S352P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104909
Gene: ENSMUSG00000020428
AA Change: S352P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 31 239 2.4e-53 PFAM
Pfam:Neur_chan_memb 246 387 9.7e-43 PFAM
transmembrane domain 422 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155218
AA Change: S353P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126114
Gene: ENSMUSG00000020428
AA Change: S353P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 240 2e-51 PFAM
Pfam:Neur_chan_memb 247 393 6.3e-35 PFAM
transmembrane domain 423 440 N/A INTRINSIC
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal cerebellar cytoarchitecture and normal responses to ethanol, pentobarbital and general anesthetics. Mice homozygous for a reporter allele are behaviorally normal and lack a cochlear phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Gabra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gabra6 APN 11 42317023 missense probably damaging 1.00
IGL01553:Gabra6 APN 11 42315196 missense probably damaging 1.00
IGL01801:Gabra6 APN 11 42315108 missense probably damaging 1.00
IGL02474:Gabra6 APN 11 42307417 missense probably benign
IGL03027:Gabra6 APN 11 42315153 missense probably damaging 1.00
IGL03111:Gabra6 APN 11 42317017 missense probably damaging 1.00
R0206:Gabra6 UTSW 11 42317079 nonsense probably null
R0240:Gabra6 UTSW 11 42314947 missense probably benign 0.01
R0726:Gabra6 UTSW 11 42315127 missense probably damaging 0.98
R0745:Gabra6 UTSW 11 42316567 missense probably damaging 0.99
R0751:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R0789:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R1666:Gabra6 UTSW 11 42317634 missense probably damaging 1.00
R1754:Gabra6 UTSW 11 42316561 missense probably damaging 1.00
R2317:Gabra6 UTSW 11 42317780 critical splice acceptor site probably null
R3605:Gabra6 UTSW 11 42314950 missense probably benign 0.00
R4647:Gabra6 UTSW 11 42307372 missense probably damaging 1.00
R5566:Gabra6 UTSW 11 42307490 missense probably benign
R5929:Gabra6 UTSW 11 42317562 missense probably damaging 0.99
R5930:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R5931:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R6155:Gabra6 UTSW 11 42316523 missense probably damaging 1.00
R7249:Gabra6 UTSW 11 42317432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTGAGAGCCTAGAGTCTGCC -3'
(R):5'- TACCCAAAGTGTCCTATGCAACCGC -3'

Sequencing Primer
(F):5'- CTAGAGTCTGCCAGGTCAAG -3'
(R):5'- AATCTCCAGTCACAGAAGGC -3'
Posted On2013-04-11