Incidental Mutation 'R0121:Serpinb1a'
ID21052
Institutional Source Beutler Lab
Gene Symbol Serpinb1a
Ensembl Gene ENSMUSG00000044734
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 1a
SynonymsMNEI, LEI, 1190005M04Rik, EIA, ovalbumin, M/NEI, ELANH2
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0121 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location32842092-32851185 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32848771 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076352] [ENSMUST00000091668]
Predicted Effect probably benign
Transcript: ENSMUST00000076352
SMART Domains Protein: ENSMUSP00000075690
Gene: ENSMUSG00000044734

DomainStartEndE-ValueType
SERPIN 13 379 1.19e-190 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091668
SMART Domains Protein: ENSMUSP00000089257
Gene: ENSMUSG00000044734

DomainStartEndE-ValueType
SERPIN 13 348 1.5e-151 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223016
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteinase inhibitors. Members of this family maintain homeostasis by neutralizing overexpressed proteinase activity through their function as suicide substrates. This protein inhibits the neutrophil-derived proteinases neutrophil elastase, cathepsin G, and proteinase-3 and thus protects tissues from damage at inflammatory sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice fail to clear P. aeruginosa lung infection and show increased mortality associated with late-onset failed bacterial clearance, partly due to elevated neutrophil necrosis, release of neutrophil protease activity, higher cytokine production and proteolysis of surfactant protein-D. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Serpinb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Serpinb1a APN 13 32845415 missense probably benign 0.03
IGL02470:Serpinb1a APN 13 32850393 missense probably damaging 0.98
IGL03215:Serpinb1a APN 13 32850369 missense probably damaging 0.99
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0047:Serpinb1a UTSW 13 32850276 missense probably damaging 1.00
R0335:Serpinb1a UTSW 13 32848656 missense probably damaging 1.00
R0387:Serpinb1a UTSW 13 32848738 missense probably benign 0.03
R0751:Serpinb1a UTSW 13 32843216 missense probably benign
R1184:Serpinb1a UTSW 13 32843216 missense probably benign
R2096:Serpinb1a UTSW 13 32847454 missense probably damaging 1.00
R2165:Serpinb1a UTSW 13 32850414 splice site probably benign
R3432:Serpinb1a UTSW 13 32842859 missense possibly damaging 0.47
R5247:Serpinb1a UTSW 13 32850406 start codon destroyed probably damaging 1.00
R5669:Serpinb1a UTSW 13 32845316 missense probably damaging 1.00
R6274:Serpinb1a UTSW 13 32842866 missense probably damaging 1.00
R7133:Serpinb1a UTSW 13 32850325 missense possibly damaging 0.69
R7358:Serpinb1a UTSW 13 32842998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACATGTCTGTGCCTGGAAAG -3'
(R):5'- TTGGGTCTCACAACAGGAATGTGTC -3'

Sequencing Primer
(F):5'- CCTGGAAAGGTCTGTGTTACTTC -3'
(R):5'- GTTAACCATTCACATTCGGGG -3'
Posted On2013-04-11