Incidental Mutation 'R0121:Anxa7'
ID21055
Institutional Source Beutler Lab
Gene Symbol Anxa7
Ensembl Gene ENSMUSG00000021814
Gene Nameannexin A7
Synonymssynexin, Anx7
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R0121 (G1)
Quality Score167
Status Validated (trace)
Chromosome14
Chromosomal Location20455260-20480133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20460159 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 386 (L386M)
Ref Sequence ENSEMBL: ENSMUSP00000153669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065504] [ENSMUST00000100844] [ENSMUST00000224975] [ENSMUST00000225941]
Predicted Effect probably damaging
Transcript: ENSMUST00000065504
AA Change: L386M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066035
Gene: ENSMUSG00000021814
AA Change: L386M

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100844
AA Change: L408M

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098405
Gene: ENSMUSG00000021814
AA Change: L408M

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224410
Predicted Effect probably damaging
Transcript: ENSMUST00000224975
AA Change: L386M

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000225941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226001
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are viable but exhibit altered Ca2+ signaling and/or homeostasis in cardiomyocytes and glia cells, and changes in erythrocyte shape, osmotic resistance, platelet number and aggregation velocity. Homozygotes for another null allele die at ~E10 with cerebral hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Anxa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Anxa7 APN 14 20458681 missense possibly damaging 0.87
IGL01137:Anxa7 APN 14 20456580 nonsense probably null
IGL01376:Anxa7 APN 14 20460456 missense probably benign 0.00
IGL01651:Anxa7 APN 14 20456501 missense probably damaging 1.00
IGL02830:Anxa7 APN 14 20456540 missense possibly damaging 0.67
IGL03078:Anxa7 APN 14 20456556 missense probably damaging 0.97
IGL03177:Anxa7 APN 14 20456586 missense probably benign 0.41
FR4449:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4548:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4737:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4976:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
LCD18:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0329:Anxa7 UTSW 14 20469498 splice site probably null
R0330:Anxa7 UTSW 14 20469498 splice site probably null
R1416:Anxa7 UTSW 14 20462707 missense probably damaging 1.00
R1601:Anxa7 UTSW 14 20464615 nonsense probably null
R1701:Anxa7 UTSW 14 20460161 missense probably damaging 1.00
R1794:Anxa7 UTSW 14 20471467 missense unknown
R1828:Anxa7 UTSW 14 20462664 missense probably damaging 1.00
R4676:Anxa7 UTSW 14 20467915 missense probably benign 0.00
R5354:Anxa7 UTSW 14 20464909 missense possibly damaging 0.63
R6547:Anxa7 UTSW 14 20469393 missense probably benign 0.13
R6985:Anxa7 UTSW 14 20471568 missense unknown
R7226:Anxa7 UTSW 14 20460195 missense probably damaging 0.97
R7267:Anxa7 UTSW 14 20469406 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACAAACAATCCTTTTGGTCGCACC -3'
(R):5'- TGCAGCCACGTTTGACAGATCC -3'

Sequencing Primer
(F):5'- TTGGTCGCACCATCAATCAC -3'
(R):5'- TGATTCTCGCCACAAGGAG -3'
Posted On2013-04-11