Incidental Mutation 'R1870:Galk2'
ID210614
Institutional Source Beutler Lab
Gene Symbol Galk2
Ensembl Gene ENSMUSG00000027207
Gene Namegalactokinase 2
Synonyms2810017M24Rik, Gk2
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1870 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125859109-125984299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125975263 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 324 (L324P)
Ref Sequence ENSEMBL: ENSMUSP00000092186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028636] [ENSMUST00000094604]
Predicted Effect probably benign
Transcript: ENSMUST00000028636
AA Change: L313P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028636
Gene: ENSMUSG00000027207
AA Change: L313P

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 13 62 3.8e-26 PFAM
Pfam:GHMP_kinases_N 120 187 1e-15 PFAM
Pfam:GHMP_kinases_C 333 419 6.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094604
AA Change: L324P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092186
Gene: ENSMUSG00000027207
AA Change: L324P

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 24 73 3.2e-25 PFAM
Pfam:GHMP_kinases_N 131 198 4.8e-15 PFAM
Pfam:GHMP_kinases_C 344 430 3.5e-14 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Dnase2a T C 8: 84,908,763 probably benign Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lpin1 A G 12: 16,541,743 F828L probably damaging Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Men1 A G 19: 6,337,630 D285G probably damaging Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr164 A T 16: 19,286,607 N45K probably damaging Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tnfrsf9 T A 4: 150,934,347 C158* probably null Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Galk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Galk2 APN 2 125896765 missense probably benign 0.29
IGL01663:Galk2 APN 2 125983179 missense probably benign
IGL01669:Galk2 APN 2 125887887 missense probably damaging 1.00
IGL01831:Galk2 APN 2 125975357 missense probably benign 0.01
IGL02055:Galk2 APN 2 125931404 missense probably benign 0.01
IGL02298:Galk2 APN 2 125859370 missense probably benign 0.00
IGL03093:Galk2 APN 2 125929643 missense probably damaging 1.00
R0305:Galk2 UTSW 2 125887888 missense probably damaging 1.00
R1713:Galk2 UTSW 2 125931290 missense probably benign 0.00
R2327:Galk2 UTSW 2 125975395 missense probably damaging 1.00
R2354:Galk2 UTSW 2 125931273 missense probably benign 0.06
R3962:Galk2 UTSW 2 125893373 missense probably benign 0.13
R4870:Galk2 UTSW 2 125929637 nonsense probably null
R5034:Galk2 UTSW 2 125929575 missense probably benign 0.00
R5427:Galk2 UTSW 2 125946821 missense probably benign 0.01
R5619:Galk2 UTSW 2 125975397 nonsense probably null
R6145:Galk2 UTSW 2 125946842 missense possibly damaging 0.90
R6173:Galk2 UTSW 2 125859217 start gained probably benign
R6287:Galk2 UTSW 2 125870348 intron probably benign
R7174:Galk2 UTSW 2 125896701 missense probably damaging 1.00
R7453:Galk2 UTSW 2 125887861 missense possibly damaging 0.51
R7480:Galk2 UTSW 2 125946925 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAAATAGAGACCTTCTGAAAACCC -3'
(R):5'- GGCAGCTGCACTCATACATG -3'

Sequencing Primer
(F):5'- ACCTGTAGTCCCAGCACTG -3'
(R):5'- TCATACATGTCCCGGCAGC -3'
Posted On2014-06-30