Incidental Mutation 'R1870:Tnfrsf9'
ID210625
Institutional Source Beutler Lab
Gene Symbol Tnfrsf9
Ensembl Gene ENSMUSG00000028965
Gene Nametumor necrosis factor receptor superfamily, member 9
SynonymsA930040I11Rik, Cd137, Ly63, ILA, CDw137, 4-1BB
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1870 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150914562-150946102 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 150934347 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 158 (C158*)
Ref Sequence ENSEMBL: ENSMUSP00000117860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030808] [ENSMUST00000060901] [ENSMUST00000105671] [ENSMUST00000105672] [ENSMUST00000116257] [ENSMUST00000126707] [ENSMUST00000135169] [ENSMUST00000139826] [ENSMUST00000169423]
Predicted Effect probably null
Transcript: ENSMUST00000030808
AA Change: C158*
SMART Domains Protein: ENSMUSP00000030808
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060901
AA Change: C158*
SMART Domains Protein: ENSMUSP00000059684
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105671
AA Change: C158*
SMART Domains Protein: ENSMUSP00000101296
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105672
AA Change: C158*
SMART Domains Protein: ENSMUSP00000101297
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000116257
AA Change: C158*
SMART Domains Protein: ENSMUSP00000111961
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126707
AA Change: C158*
SMART Domains Protein: ENSMUSP00000122917
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135169
AA Change: C158*
SMART Domains Protein: ENSMUSP00000120761
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139826
AA Change: C158*
SMART Domains Protein: ENSMUSP00000117860
Gene: ENSMUSG00000028965
AA Change: C158*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146133
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced T cell proliferation, decreased B cell IgG production, decreased cytotoxic T cell activity, and increased numbers of erythrocytes, granulocyte macrophages, and multipotential progenitor cells in the bone marrow, blood, and spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Dnase2a T C 8: 84,908,763 probably benign Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Galk2 T C 2: 125,975,263 L324P probably benign Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lpin1 A G 12: 16,541,743 F828L probably damaging Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Men1 A G 19: 6,337,630 D285G probably damaging Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr164 A T 16: 19,286,607 N45K probably damaging Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Tnfrsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
asilomar UTSW 4 150929874 missense probably benign 0.01
FR4304:Tnfrsf9 UTSW 4 150934395 intron probably benign
FR4342:Tnfrsf9 UTSW 4 150934394 intron probably benign
R1496:Tnfrsf9 UTSW 4 150933104 critical splice donor site probably null
R5596:Tnfrsf9 UTSW 4 150929874 missense probably benign 0.01
R7219:Tnfrsf9 UTSW 4 150935534 missense probably damaging 1.00
R7322:Tnfrsf9 UTSW 4 150934337 missense probably damaging 1.00
R7440:Tnfrsf9 UTSW 4 150929874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTCTTGGTACCTCTTGG -3'
(R):5'- TGCCCATGGAGTCTGAATGG -3'

Sequencing Primer
(F):5'- GGCACTTTCTCACATCATCTGC -3'
(R):5'- CCCATGGAGTCTGAATGGACATC -3'
Posted On2014-06-30