Incidental Mutation 'R1870:Olfr164'
ID210696
Institutional Source Beutler Lab
Gene Symbol Olfr164
Ensembl Gene ENSMUSG00000050742
Gene Nameolfactory receptor 164
SynonymsGA_x54KRFPKG5P-15738260-15737319, MOR279-2
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1870 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19284104-19314064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19286607 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 45 (N45K)
Ref Sequence ENSEMBL: ENSMUSP00000149971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056727] [ENSMUST00000216157]
Predicted Effect probably damaging
Transcript: ENSMUST00000056727
AA Change: N45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056970
Gene: ENSMUSG00000050742
AA Change: N45K

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.2e-8 PFAM
Pfam:7tm_1 44 293 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216157
AA Change: N45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0348 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Dnase2a T C 8: 84,908,763 probably benign Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Galk2 T C 2: 125,975,263 L324P probably benign Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lpin1 A G 12: 16,541,743 F828L probably damaging Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Men1 A G 19: 6,337,630 D285G probably damaging Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tnfrsf9 T A 4: 150,934,347 C158* probably null Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Olfr164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Olfr164 APN 16 19286700 missense probably benign 0.01
IGL01569:Olfr164 APN 16 19286660 missense probably benign 0.28
IGL01619:Olfr164 APN 16 19286159 missense probably damaging 1.00
IGL02101:Olfr164 APN 16 19286613 missense probably benign
IGL02201:Olfr164 APN 16 19286462 missense probably benign 0.03
IGL02730:Olfr164 APN 16 19286682 missense probably benign 0.00
IGL03228:Olfr164 APN 16 19286390 missense probably damaging 1.00
R1566:Olfr164 UTSW 16 19286327 missense possibly damaging 0.76
R1817:Olfr164 UTSW 16 19285877 missense probably damaging 1.00
R1918:Olfr164 UTSW 16 19286302 missense probably benign 0.03
R2202:Olfr164 UTSW 16 19286297 missense probably benign 0.03
R2265:Olfr164 UTSW 16 19286555 missense probably damaging 1.00
R3792:Olfr164 UTSW 16 19285946 missense possibly damaging 0.54
R4285:Olfr164 UTSW 16 19285964 missense probably damaging 1.00
R4961:Olfr164 UTSW 16 19285976 missense probably damaging 1.00
R5022:Olfr164 UTSW 16 19286059 missense probably damaging 1.00
R5432:Olfr164 UTSW 16 19286089 missense probably benign 0.06
R5827:Olfr164 UTSW 16 19286432 missense probably benign 0.24
R6154:Olfr164 UTSW 16 19286431 missense probably damaging 0.99
R6188:Olfr164 UTSW 16 19286557 missense probably damaging 1.00
R6367:Olfr164 UTSW 16 19286072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATTCCACAGCCAACCATG -3'
(R):5'- CAACACTGTGTCATTCTAGCTTGG -3'

Sequencing Primer
(F):5'- GAGCATGAGATCCATGAGAG -3'
(R):5'- GGACCAGGAACTCTGATT -3'
Posted On2014-06-30