Incidental Mutation 'R1870:Men1'
ID210704
Institutional Source Beutler Lab
Gene Symbol Men1
Ensembl Gene ENSMUSG00000024947
Gene Namemultiple endocrine neoplasia 1
Synonymsmenin
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1870 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6334979-6340891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6337630 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 285 (D285G)
Ref Sequence ENSEMBL: ENSMUSP00000109132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349] [ENSMUST00000166909] [ENSMUST00000170132]
Predicted Effect probably benign
Transcript: ENSMUST00000025897
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056391
AA Change: D285G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947
AA Change: D285G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078137
AA Change: D285G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947
AA Change: D285G

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079327
AA Change: D285G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947
AA Change: D285G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113500
AA Change: D285G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947
AA Change: D285G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113501
AA Change: D250G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947
AA Change: D250G

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113502
AA Change: D291G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947
AA Change: D291G

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113503
AA Change: D290G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947
AA Change: D290G

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113504
AA Change: D285G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947
AA Change: D285G

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124333
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127809
Predicted Effect probably benign
Transcript: ENSMUST00000130382
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134307
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152259
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156154
Predicted Effect probably benign
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170132
AA Change: D74G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126655
Gene: ENSMUSG00000024947
AA Change: D74G

DomainStartEndE-ValueType
Pfam:Menin 1 135 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170292
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-13.5 with reduced size, edema, open neural tube and defects of the nervous system, heart and liver. Heterozygotes develop tumors of the pancreas, parathyroid, thyroid, adrenal and pituitary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Dnase2a T C 8: 84,908,763 probably benign Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Galk2 T C 2: 125,975,263 L324P probably benign Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lpin1 A G 12: 16,541,743 F828L probably damaging Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr164 A T 16: 19,286,607 N45K probably damaging Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tnfrsf9 T A 4: 150,934,347 C158* probably null Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Men1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Men1 APN 19 6337207 intron probably null
IGL00160:Men1 APN 19 6337207 intron probably null
IGL00161:Men1 APN 19 6337207 intron probably null
IGL00229:Men1 APN 19 6337207 intron probably null
IGL00231:Men1 APN 19 6337207 intron probably null
IGL00232:Men1 APN 19 6337207 intron probably null
IGL00434:Men1 APN 19 6337207 intron probably null
IGL00467:Men1 APN 19 6337207 intron probably null
IGL00468:Men1 APN 19 6337207 intron probably null
IGL00470:Men1 APN 19 6337207 intron probably null
IGL00476:Men1 APN 19 6337207 intron probably null
IGL02305:Men1 APN 19 6340138 missense probably damaging 1.00
R0468:Men1 UTSW 19 6336923 missense probably null 0.99
R0856:Men1 UTSW 19 6335858 missense probably damaging 1.00
R1384:Men1 UTSW 19 6339891 missense probably benign 0.12
R1987:Men1 UTSW 19 6338837 missense probably damaging 0.99
R2321:Men1 UTSW 19 6339838 missense possibly damaging 0.92
R4538:Men1 UTSW 19 6336754 missense possibly damaging 0.89
R4763:Men1 UTSW 19 6335072 critical splice donor site probably null
R6147:Men1 UTSW 19 6337242 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCACTTCTCTAGCTGACTGGG -3'
(R):5'- CCAGGGCTCTTCTTAAACACAG -3'

Sequencing Primer
(F):5'- TCTCTAGCTGACTGGGGCTCC -3'
(R):5'- GGGCTCTTCTTAAACACAGAACTAC -3'
Posted On2014-06-30