Incidental Mutation 'R1871:Unc80'
ID210707
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R1871 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66510717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 711 (R711S)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: R711S

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: R711S

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212557
AA Change: R711S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Chd6 T C 2: 160,990,256 T999A probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Ephx2 A T 14: 66,084,734 I538N probably damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Tecta G A 9: 42,337,176 L1977F probably damaging Het
Tecta G C 9: 42,337,340 T1917R probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 intron probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 intron probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCGGGTACTGAATTGTCCTACG -3'
(R):5'- CATTCTTCTCATAAGGGCCACC -3'

Sequencing Primer
(F):5'- GGGTACTGAATTGTCCTACGTTTACC -3'
(R):5'- AGGGCCACCTCCACCTC -3'
Posted On2014-06-30