Incidental Mutation 'R1871:Chd6'
ID210717
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R1871 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160990256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 999 (T999A)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: T999A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: T999A

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134178
AA Change: T998A

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: T998A

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149866
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Ephx2 A T 14: 66,084,734 I538N probably damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Tecta G A 9: 42,337,176 L1977F probably damaging Het
Tecta G C 9: 42,337,340 T1917R probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Unc80 A T 1: 66,510,717 R711S possibly damaging Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGATGTGGCTACTAGCTTCTC -3'
(R):5'- ATCCTGAATCACGAGGGCTG -3'

Sequencing Primer
(F):5'- GGATGTGGCTACTAGCTTCTCTTTAC -3'
(R):5'- CACTTTGGTGACCTGCTCAGG -3'
Posted On2014-06-30