Incidental Mutation 'R1871:Tecta'
ID210748
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1871 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 42337340 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 1917 (T1917R)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: T1922R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: T1922R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159603
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: T1917R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: T1917R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Chd6 T C 2: 160,990,256 T999A probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Ephx2 A T 14: 66,084,734 I538N probably damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Unc80 A T 1: 66,510,717 R711S possibly damaging Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCGATGATGAAGTACCGAAGC -3'
(R):5'- TTTAAACTTGAGGACTGCATGCC -3'

Sequencing Primer
(F):5'- TGATGAAGTACCGAAGCTTGTC -3'
(R):5'- GAGGACTGCATGCCATGTCTTC -3'
Posted On2014-06-30