Incidental Mutation 'R1871:Pfas'
ID210764
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1871 (G1)
Quality Score161
Status Validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68991969 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 782 (D782G)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: D782G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: D782G

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152964
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Chd6 T C 2: 160,990,256 T999A probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Ephx2 A T 14: 66,084,734 I538N probably damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Tecta G A 9: 42,337,176 L1977F probably damaging Het
Tecta G C 9: 42,337,340 T1917R probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Unc80 A T 1: 66,510,717 R711S possibly damaging Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGACCCTACCGAGCAAAG -3'
(R):5'- TGTTTGCTCTGGTCACCGAC -3'

Sequencing Primer
(F):5'- TAAGACCAAGTGAGGTAGCAGCC -3'
(R):5'- ACCTCCGAGTGAGTCCTC -3'
Posted On2014-06-30