Incidental Mutation 'R1871:Slfn9'
ID210766
Institutional Source Beutler Lab
Gene Symbol Slfn9
Ensembl Gene ENSMUSG00000069793
Gene Nameschlafen 9
Synonyms
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1871 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82978390-82991830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82981576 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 778 (T778N)
Ref Sequence ENSEMBL: ENSMUSP00000090515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038211] [ENSMUST00000092840] [ENSMUST00000138797]
Predicted Effect probably benign
Transcript: ENSMUST00000038211
AA Change: T778N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044435
Gene: ENSMUSG00000069793
AA Change: T778N

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AlbA_2 205 343 2.3e-17 PFAM
Pfam:DUF2075 592 766 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092840
AA Change: T778N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090515
Gene: ENSMUSG00000069793
AA Change: T778N

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 1.6e-18 PFAM
Pfam:DUF2075 592 766 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138797
SMART Domains Protein: ENSMUSP00000115273
Gene: ENSMUSG00000069793

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
Pfam:AAA_4 205 344 3.8e-19 PFAM
Pfam:DUF2075 592 642 1.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183379
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Chd6 T C 2: 160,990,256 T999A probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Ephx2 A T 14: 66,084,734 I538N probably damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Tecta G A 9: 42,337,176 L1977F probably damaging Het
Tecta G C 9: 42,337,340 T1917R probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Unc80 A T 1: 66,510,717 R711S possibly damaging Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Slfn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Slfn9 APN 11 82981371 nonsense probably null
IGL01340:Slfn9 APN 11 82981751 missense probably benign 0.29
IGL01543:Slfn9 APN 11 82987949 missense probably benign
IGL01735:Slfn9 APN 11 82982332 missense probably damaging 1.00
IGL01778:Slfn9 APN 11 82987374 missense probably damaging 0.98
IGL01863:Slfn9 APN 11 82981325 missense probably benign 0.27
IGL01997:Slfn9 APN 11 82987677 missense possibly damaging 0.80
IGL02380:Slfn9 APN 11 82981220 missense probably benign 0.23
IGL02993:Slfn9 APN 11 82981196 missense probably benign 0.18
R1463:Slfn9 UTSW 11 82981698 missense possibly damaging 0.78
R1687:Slfn9 UTSW 11 82982157 missense probably damaging 0.99
R1786:Slfn9 UTSW 11 82981307 missense probably damaging 0.99
R1796:Slfn9 UTSW 11 82981955 missense probably benign 0.00
R1870:Slfn9 UTSW 11 82981576 missense probably benign
R2004:Slfn9 UTSW 11 82988201 missense probably benign 0.25
R2024:Slfn9 UTSW 11 82981681 missense probably damaging 1.00
R2106:Slfn9 UTSW 11 82987680 missense possibly damaging 0.89
R2140:Slfn9 UTSW 11 82984655 missense possibly damaging 0.76
R3004:Slfn9 UTSW 11 82981764 missense possibly damaging 0.94
R4293:Slfn9 UTSW 11 82982508 missense probably benign 0.01
R4927:Slfn9 UTSW 11 82981390 missense possibly damaging 0.47
R4950:Slfn9 UTSW 11 82981904 missense probably benign
R5471:Slfn9 UTSW 11 82982787 missense possibly damaging 0.85
R5543:Slfn9 UTSW 11 82982381 missense probably damaging 1.00
R5576:Slfn9 UTSW 11 82981432 missense probably benign
R5996:Slfn9 UTSW 11 82987484 missense possibly damaging 0.67
R7272:Slfn9 UTSW 11 82981561 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCGTCATTCATGTGAGATGCTC -3'
(R):5'- AGTCACTTGCAGGAGAGTGG -3'

Sequencing Primer
(F):5'- ATTCATGTGAGATGCTCTCCTC -3'
(R):5'- AGAGTGGCCTCCCAGATTTC -3'
Posted On2014-06-30