Incidental Mutation 'R1872:Mrc1'
ID210802
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Namemannose receptor, C type 1
SynonymsCD206, MR
MMRRC Submission 039894-MU
Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1872 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14229392-14332057 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 14325381 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028045
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146168
Meta Mutation Damage Score 0.658 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,844 C133Y unknown Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 A G 8: 79,690,251 M377T possibly damaging Het
Adam25 A T 8: 40,755,226 R510* probably null Het
Adamts12 G T 15: 11,217,880 E308* probably null Het
Adgrg3 C A 8: 95,033,442 N96K possibly damaging Het
Afdn T C 17: 13,881,316 V1022A probably damaging Het
Akap9 T C 5: 4,001,406 V1391A probably damaging Het
Akip1 A G 7: 109,711,775 Y174C probably damaging Het
Ap3b2 T C 7: 81,464,150 T830A unknown Het
Aph1a A G 3: 95,895,564 T159A probably damaging Het
Ccdc146 T C 5: 21,301,290 T718A probably benign Het
Cdk5r2 T C 1: 74,855,822 L242P probably damaging Het
Cep97 T A 16: 55,927,866 N67I probably damaging Het
Chic2 A T 5: 75,011,479 W121R possibly damaging Het
Clock A G 5: 76,248,462 S147P possibly damaging Het
Cntnap5a T G 1: 116,089,210 S178A probably benign Het
Col11a2 C A 17: 34,062,555 probably benign Het
Col6a3 T A 1: 90,830,214 H6L probably damaging Het
Cpne5 T C 17: 29,204,693 N154D probably benign Het
Ctsz T G 2: 174,427,976 K273Q probably benign Het
Cybrd1 G A 2: 71,129,760 V101M probably benign Het
Cyp2c23 T A 19: 44,005,551 K459* probably null Het
Cyp4a31 A T 4: 115,574,736 H419L probably damaging Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dnah9 C T 11: 66,037,490 V2118M probably benign Het
Doxl2 A G 6: 48,975,620 I160V probably benign Het
Dtna T C 18: 23,597,560 probably null Het
Ednra C T 8: 77,720,396 V18I possibly damaging Het
Elac1 T C 18: 73,742,646 R105G probably benign Het
Exoc2 A G 13: 30,822,661 S844P probably benign Het
Fam185a A T 5: 21,480,330 probably null Het
Fam204a A G 19: 60,199,449 M233T possibly damaging Het
Fat1 C A 8: 44,953,304 H1031N probably benign Het
Fat1 T A 8: 45,038,349 Y3816N probably damaging Het
Fbxo38 C T 18: 62,517,023 R621Q probably benign Het
Fhod3 C A 18: 25,130,610 R1524S probably damaging Het
Fnip1 A T 11: 54,487,735 R192W probably damaging Het
Frem3 T A 8: 80,612,576 H499Q probably damaging Het
Gab2 C T 7: 97,299,043 T280I probably damaging Het
Gdpgp1 A G 7: 80,238,424 R68G probably benign Het
Gm10382 C T 5: 125,389,560 probably benign Het
Gm4858 T A 3: 93,074,422 L249H probably damaging Het
Gmps A G 3: 64,001,517 H480R probably benign Het
Hecw1 G A 13: 14,280,449 R674* probably null Het
Herc2 T A 7: 56,157,509 F2478L probably benign Het
Homer2 C T 7: 81,636,402 V21M probably damaging Het
Ifna9 A G 4: 88,592,255 M44T probably damaging Het
Igfl3 A G 7: 18,179,896 D57G possibly damaging Het
Jcad T C 18: 4,673,048 M270T probably benign Het
Kdm5b T C 1: 134,624,994 L1236P probably damaging Het
Kif14 T A 1: 136,486,358 L724Q probably damaging Het
Lhb T C 7: 45,421,333 V45A probably damaging Het
Lhpp A G 7: 132,634,087 N134D probably benign Het
Mas1 T C 17: 12,842,191 Y115C probably damaging Het
Mb21d1 T C 9: 78,433,202 D416G probably benign Het
Mgam A T 6: 40,661,300 K395* probably null Het
Mms22l A G 4: 24,598,807 N1134S probably damaging Het
Mrgprg G A 7: 143,764,544 S277L probably damaging Het
Mrpl49 G T 19: 6,056,980 P60T possibly damaging Het
Mrps10 G A 17: 47,372,452 G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 Y120C probably damaging Het
N4bp2 C T 5: 65,794,518 probably benign Het
Nbea A G 3: 55,642,889 V2706A probably benign Het
Nfic T A 10: 81,420,684 M71L possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1112 A G 2: 87,191,878 T64A possibly damaging Het
Olfr115 G T 17: 37,609,912 P280T probably damaging Het
Olfr1202 T A 2: 88,817,936 V255E probably benign Het
Olfr1234 A G 2: 89,362,589 L280P probably damaging Het
Pak7 T C 2: 136,085,588 I655V possibly damaging Het
Pip5k1c A G 10: 81,306,319 N121S probably damaging Het
Plce1 A T 19: 38,760,077 I1737F probably damaging Het
Prrt1 T C 17: 34,630,951 L113P probably damaging Het
Ptprq T A 10: 107,643,999 T1137S probably benign Het
Recql5 T C 11: 115,923,309 I223V probably benign Het
Reg3g A T 6: 78,467,853 Y47* probably null Het
Rgs12 T G 5: 34,965,821 M316R probably damaging Het
Ric1 T C 19: 29,602,668 S1290P probably benign Het
Rpl36al A G 12: 69,182,923 C72R probably damaging Het
Rplp0 T A 5: 115,563,315 F275L possibly damaging Het
Rpp30 G A 19: 36,087,393 V89I probably benign Het
Ryr3 A G 2: 112,709,137 F3253L possibly damaging Het
Serpina3n A T 12: 104,408,944 N92Y probably benign Het
Setd7 G T 3: 51,542,831 T58N probably benign Het
Sh3tc2 T A 18: 62,011,883 L1136Q probably damaging Het
Slc35b4 G A 6: 34,158,505 Q291* probably null Het
Soga1 A G 2: 157,040,261 C624R possibly damaging Het
Sort1 A G 3: 108,340,695 N452S probably benign Het
Sympk A G 7: 19,029,145 I46V probably benign Het
Syngr2 T C 11: 117,812,538 V60A probably damaging Het
Syt17 A T 7: 118,408,118 F318I probably benign Het
Tgfb1 T A 7: 25,692,466 L149M probably damaging Het
Ticam1 A T 17: 56,271,897 M66K probably benign Het
Tmem131 G T 1: 36,807,927 D1363E probably benign Het
Tns4 A C 11: 99,080,100 D261E probably damaging Het
Trim30a T C 7: 104,429,210 N220D probably benign Het
Trmt10a T C 3: 138,156,720 L257P probably damaging Het
Troap G T 15: 99,075,352 probably benign Het
Ttc6 T C 12: 57,704,552 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vav1 A C 17: 57,324,750 K775T probably damaging Het
Vmn1r236 A G 17: 21,287,411 K264E possibly damaging Het
Vmn1r84 A G 7: 12,362,628 V46A probably benign Het
Wdr59 A T 8: 111,459,017 W835R probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp7 T G 15: 76,891,777 I673S probably benign Het
Zmynd11 A G 13: 9,698,701 I108T possibly damaging Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14328425 missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14266524 missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14310084 critical splice donor site probably null
IGL01758:Mrc1 APN 2 14238248 missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14238376 missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14244213 missense probably benign 0.19
IGL02435:Mrc1 APN 2 14248860 nonsense probably null
IGL03073:Mrc1 APN 2 14305342 missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14293478 nonsense probably null
IGL03155:Mrc1 APN 2 14331101 missense probably benign 0.00
IGL03289:Mrc1 APN 2 14308823 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0110:Mrc1 UTSW 2 14238542 splice site probably benign
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14307909 missense probably benign 0.05
R0505:Mrc1 UTSW 2 14310032 missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14270126 splice site probably benign
R0613:Mrc1 UTSW 2 14294819 missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14328571 nonsense probably null
R1122:Mrc1 UTSW 2 14261336 critical splice donor site probably null
R1281:Mrc1 UTSW 2 14293510 missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14279925 missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14315263 missense probably benign 0.11
R1571:Mrc1 UTSW 2 14308733 missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14248890 missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1733:Mrc1 UTSW 2 14257099 missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1860:Mrc1 UTSW 2 14328579 missense probably benign 0.30
R1889:Mrc1 UTSW 2 14308677 critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14319241 missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14244292 critical splice donor site probably null
R2031:Mrc1 UTSW 2 14321773 missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14270189 missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14327864 missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14244204 missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14325372 missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14328543 missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14319170 missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14288982 splice site probably benign
R4028:Mrc1 UTSW 2 14238248 missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14293486 missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14270206 missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14319141 missense probably benign 0.01
R4950:Mrc1 UTSW 2 14271280 missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14244189 missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14306516 missense probably benign 0.00
R5279:Mrc1 UTSW 2 14310058 missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14321914 missense probably benign 0.03
R5436:Mrc1 UTSW 2 14266515 missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14279957 missense probably benign 0.05
R5631:Mrc1 UTSW 2 14328572 nonsense probably null
R5831:Mrc1 UTSW 2 14308712 missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14315393 missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14305327 missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14271304 missense probably benign 0.08
R6344:Mrc1 UTSW 2 14244174 missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14270205 missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14307949 missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14294786 splice site probably null
R6631:Mrc1 UTSW 2 14238485 missense probably benign
R6737:Mrc1 UTSW 2 14271277 missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R6887:Mrc1 UTSW 2 14325237 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCAGCAACCCCAGCTTTTATTTATG -3'
(R):5'- GTGGGAAATGATGTTGACCATTCTG -3'

Sequencing Primer
(F):5'- AGACTGCGTGGATTCCTT -3'
(R):5'- CACATATGGTTGGGAATGTAGCTCAC -3'
Posted On2014-06-30