Incidental Mutation 'R1872:Fat1'
ID210855
Institutional Source Beutler Lab
Gene Symbol Fat1
Ensembl Gene ENSMUSG00000070047
Gene NameFAT atypical cadherin 1
SynonymsmFat1, Fath, 2310038E12Rik
MMRRC Submission 039894-MU
Accession Numbers

Genbank: NM_001081286

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1872 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location44935447-45052257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44953304 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 1031 (H1031N)
Ref Sequence ENSEMBL: ENSMUSP00000140765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098796] [ENSMUST00000189017] [ENSMUST00000191428] [ENSMUST00000215588]
Predicted Effect probably benign
Transcript: ENSMUST00000098796
AA Change: H1031N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096394
Gene: ENSMUSG00000070047
AA Change: H1031N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189017
AA Change: H1031N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000191428
AA Change: H1031N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140596
Gene: ENSMUSG00000070047
AA Change: H1031N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 62 148 3.05e-6 SMART
CA 172 256 3.29e-20 SMART
Blast:CA 277 382 5e-47 BLAST
CA 387 462 2.13e-5 SMART
CA 486 568 8.35e-22 SMART
CA 592 670 2.11e-2 SMART
CA 740 821 5.09e-26 SMART
CA 845 926 6.27e-26 SMART
CA 950 1031 4.07e-25 SMART
CA 1057 1138 5.13e-31 SMART
CA 1162 1244 8.79e-30 SMART
CA 1276 1351 2.06e-3 SMART
CA 1379 1456 1.63e-15 SMART
CA 1480 1562 3.29e-20 SMART
CA 1586 1667 2.34e-16 SMART
CA 1691 1765 1.16e-20 SMART
CA 1796 1879 6.27e-26 SMART
CA 1903 1979 1.47e-8 SMART
CA 2003 2081 2.65e-15 SMART
CA 2105 2181 2.14e-10 SMART
CA 2203 2283 9.82e-19 SMART
CA 2307 2390 7.54e-29 SMART
CA 2414 2492 3.29e-11 SMART
CA 2516 2596 6.48e-19 SMART
CA 2620 2703 3.48e-10 SMART
CA 2719 2809 2.26e-9 SMART
CA 2833 2918 8.08e-29 SMART
CA 2942 3023 5.99e-23 SMART
CA 3047 3125 2.63e-28 SMART
CA 3149 3230 2.79e-32 SMART
CA 3254 3335 5.25e-28 SMART
CA 3359 3440 4.46e-31 SMART
CA 3464 3545 1.25e-11 SMART
CA 3569 3641 5.67e-2 SMART
LamG 3853 3987 6.51e-36 SMART
EGF 4018 4052 8.57e-5 SMART
EGF 4057 4090 3.94e-4 SMART
EGF 4094 4127 4.29e-5 SMART
EGF_CA 4129 4165 1.81e-12 SMART
transmembrane domain 4182 4204 N/A INTRINSIC
low complexity region 4308 4324 N/A INTRINSIC
low complexity region 4436 4457 N/A INTRINSIC
low complexity region 4472 4483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215588
AA Change: H1031N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has five epidermal growth factor (EGF)-like repeats and one laminin A-G domain. This gene is expressed at high levels in a number of fetal epithelia. Its product probably functions as an adhesion molecule and/or signaling receptor, and is likely to be important in developmental processes and cell communication. Transcript variants derived from alternative splicing and/or alternative promoter usage exist, but they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit holoprosencephaly, anophthalmia, kidney defects and perinatal lethality. Mice homozygous for a hypomorphic allele exhibit altered shoulder girdle and facial musculature, retinal defects, abnormal inner earpatterning and kidney defects. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Targeted, other(1) Gene trapped(55)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,844 C133Y unknown Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 A G 8: 79,690,251 M377T possibly damaging Het
Adam25 A T 8: 40,755,226 R510* probably null Het
Adamts12 G T 15: 11,217,880 E308* probably null Het
Adgrg3 C A 8: 95,033,442 N96K possibly damaging Het
Afdn T C 17: 13,881,316 V1022A probably damaging Het
Akap9 T C 5: 4,001,406 V1391A probably damaging Het
Akip1 A G 7: 109,711,775 Y174C probably damaging Het
Ap3b2 T C 7: 81,464,150 T830A unknown Het
Aph1a A G 3: 95,895,564 T159A probably damaging Het
Ccdc146 T C 5: 21,301,290 T718A probably benign Het
Cdk5r2 T C 1: 74,855,822 L242P probably damaging Het
Cep97 T A 16: 55,927,866 N67I probably damaging Het
Chic2 A T 5: 75,011,479 W121R possibly damaging Het
Clock A G 5: 76,248,462 S147P possibly damaging Het
Cntnap5a T G 1: 116,089,210 S178A probably benign Het
Col11a2 C A 17: 34,062,555 probably benign Het
Col6a3 T A 1: 90,830,214 H6L probably damaging Het
Cpne5 T C 17: 29,204,693 N154D probably benign Het
Ctsz T G 2: 174,427,976 K273Q probably benign Het
Cybrd1 G A 2: 71,129,760 V101M probably benign Het
Cyp2c23 T A 19: 44,005,551 K459* probably null Het
Cyp4a31 A T 4: 115,574,736 H419L probably damaging Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dnah9 C T 11: 66,037,490 V2118M probably benign Het
Doxl2 A G 6: 48,975,620 I160V probably benign Het
Dtna T C 18: 23,597,560 probably null Het
Ednra C T 8: 77,720,396 V18I possibly damaging Het
Elac1 T C 18: 73,742,646 R105G probably benign Het
Exoc2 A G 13: 30,822,661 S844P probably benign Het
Fam185a A T 5: 21,480,330 probably null Het
Fam204a A G 19: 60,199,449 M233T possibly damaging Het
Fbxo38 C T 18: 62,517,023 R621Q probably benign Het
Fhod3 C A 18: 25,130,610 R1524S probably damaging Het
Fnip1 A T 11: 54,487,735 R192W probably damaging Het
Frem3 T A 8: 80,612,576 H499Q probably damaging Het
Gab2 C T 7: 97,299,043 T280I probably damaging Het
Gdpgp1 A G 7: 80,238,424 R68G probably benign Het
Gm10382 C T 5: 125,389,560 probably benign Het
Gm4858 T A 3: 93,074,422 L249H probably damaging Het
Gmps A G 3: 64,001,517 H480R probably benign Het
Hecw1 G A 13: 14,280,449 R674* probably null Het
Herc2 T A 7: 56,157,509 F2478L probably benign Het
Homer2 C T 7: 81,636,402 V21M probably damaging Het
Ifna9 A G 4: 88,592,255 M44T probably damaging Het
Igfl3 A G 7: 18,179,896 D57G possibly damaging Het
Jcad T C 18: 4,673,048 M270T probably benign Het
Kdm5b T C 1: 134,624,994 L1236P probably damaging Het
Kif14 T A 1: 136,486,358 L724Q probably damaging Het
Lhb T C 7: 45,421,333 V45A probably damaging Het
Lhpp A G 7: 132,634,087 N134D probably benign Het
Mas1 T C 17: 12,842,191 Y115C probably damaging Het
Mb21d1 T C 9: 78,433,202 D416G probably benign Het
Mgam A T 6: 40,661,300 K395* probably null Het
Mms22l A G 4: 24,598,807 N1134S probably damaging Het
Mrc1 A G 2: 14,325,381 probably null Het
Mrgprg G A 7: 143,764,544 S277L probably damaging Het
Mrpl49 G T 19: 6,056,980 P60T possibly damaging Het
Mrps10 G A 17: 47,372,452 G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 Y120C probably damaging Het
N4bp2 C T 5: 65,794,518 probably benign Het
Nbea A G 3: 55,642,889 V2706A probably benign Het
Nfic T A 10: 81,420,684 M71L possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1112 A G 2: 87,191,878 T64A possibly damaging Het
Olfr115 G T 17: 37,609,912 P280T probably damaging Het
Olfr1202 T A 2: 88,817,936 V255E probably benign Het
Olfr1234 A G 2: 89,362,589 L280P probably damaging Het
Pak7 T C 2: 136,085,588 I655V possibly damaging Het
Pip5k1c A G 10: 81,306,319 N121S probably damaging Het
Plce1 A T 19: 38,760,077 I1737F probably damaging Het
Prrt1 T C 17: 34,630,951 L113P probably damaging Het
Ptprq T A 10: 107,643,999 T1137S probably benign Het
Recql5 T C 11: 115,923,309 I223V probably benign Het
Reg3g A T 6: 78,467,853 Y47* probably null Het
Rgs12 T G 5: 34,965,821 M316R probably damaging Het
Ric1 T C 19: 29,602,668 S1290P probably benign Het
Rpl36al A G 12: 69,182,923 C72R probably damaging Het
Rplp0 T A 5: 115,563,315 F275L possibly damaging Het
Rpp30 G A 19: 36,087,393 V89I probably benign Het
Ryr3 A G 2: 112,709,137 F3253L possibly damaging Het
Serpina3n A T 12: 104,408,944 N92Y probably benign Het
Setd7 G T 3: 51,542,831 T58N probably benign Het
Sh3tc2 T A 18: 62,011,883 L1136Q probably damaging Het
Slc35b4 G A 6: 34,158,505 Q291* probably null Het
Soga1 A G 2: 157,040,261 C624R possibly damaging Het
Sort1 A G 3: 108,340,695 N452S probably benign Het
Sympk A G 7: 19,029,145 I46V probably benign Het
Syngr2 T C 11: 117,812,538 V60A probably damaging Het
Syt17 A T 7: 118,408,118 F318I probably benign Het
Tgfb1 T A 7: 25,692,466 L149M probably damaging Het
Ticam1 A T 17: 56,271,897 M66K probably benign Het
Tmem131 G T 1: 36,807,927 D1363E probably benign Het
Tns4 A C 11: 99,080,100 D261E probably damaging Het
Trim30a T C 7: 104,429,210 N220D probably benign Het
Trmt10a T C 3: 138,156,720 L257P probably damaging Het
Troap G T 15: 99,075,352 probably benign Het
Ttc6 T C 12: 57,704,552 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vav1 A C 17: 57,324,750 K775T probably damaging Het
Vmn1r236 A G 17: 21,287,411 K264E possibly damaging Het
Vmn1r84 A G 7: 12,362,628 V46A probably benign Het
Wdr59 A T 8: 111,459,017 W835R probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp7 T G 15: 76,891,777 I673S probably benign Het
Zmynd11 A G 13: 9,698,701 I108T possibly damaging Het
Other mutations in Fat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fat1 APN 8 45024602 missense possibly damaging 0.93
IGL00157:Fat1 APN 8 44951670 missense possibly damaging 0.96
IGL00481:Fat1 APN 8 45050940 missense probably benign 0.18
IGL00983:Fat1 APN 8 45033390 missense probably damaging 1.00
IGL01089:Fat1 APN 8 45017857 missense probably damaging 1.00
IGL01135:Fat1 APN 8 45024840 missense probably damaging 1.00
IGL01143:Fat1 APN 8 45035532 missense possibly damaging 0.72
IGL01155:Fat1 APN 8 45023949 missense probably damaging 1.00
IGL01376:Fat1 APN 8 45026841 missense probably benign 0.00
IGL01411:Fat1 APN 8 45026800 missense probably damaging 1.00
IGL01443:Fat1 APN 8 45040576 missense probably damaging 1.00
IGL01453:Fat1 APN 8 45051270 missense probably damaging 1.00
IGL01606:Fat1 APN 8 45023049 missense probably benign 0.26
IGL01622:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01623:Fat1 APN 8 45029555 missense possibly damaging 0.64
IGL01672:Fat1 APN 8 45040700 missense probably benign 0.05
IGL01735:Fat1 APN 8 45036239 missense probably benign 0.07
IGL01793:Fat1 APN 8 44989112 missense probably benign
IGL01820:Fat1 APN 8 45010502 missense probably damaging 1.00
IGL01969:Fat1 APN 8 44952599 missense probably damaging 0.98
IGL02012:Fat1 APN 8 45027540 missense possibly damaging 0.95
IGL02227:Fat1 APN 8 45023659 missense probably damaging 1.00
IGL02256:Fat1 APN 8 44950332 missense probably damaging 1.00
IGL02273:Fat1 APN 8 44950331 missense probably damaging 1.00
IGL02317:Fat1 APN 8 45025818 missense probably benign 0.33
IGL02324:Fat1 APN 8 45040556 missense probably damaging 1.00
IGL02336:Fat1 APN 8 44951583 missense probably benign 0.16
IGL02442:Fat1 APN 8 44950323 missense probably benign 0.02
IGL02486:Fat1 APN 8 45025072 missense probably benign 0.16
IGL02551:Fat1 APN 8 45051398 missense probably damaging 1.00
IGL02617:Fat1 APN 8 45035591 missense probably benign 0.31
IGL02698:Fat1 APN 8 45023164 missense probably benign
IGL02885:Fat1 APN 8 44989167 missense probably benign 0.01
IGL02904:Fat1 APN 8 45040682 missense probably damaging 1.00
IGL02953:Fat1 APN 8 45024314 missense probably damaging 1.00
IGL03108:Fat1 APN 8 45023614 missense probably damaging 1.00
IGL03153:Fat1 APN 8 45030123 missense possibly damaging 0.83
IGL03183:Fat1 APN 8 44950586 missense probably damaging 0.99
IGL03327:Fat1 APN 8 44950468 missense probably damaging 1.00
IGL03405:Fat1 APN 8 45025241 missense probably damaging 1.00
laggardly UTSW 8 45044464 missense probably damaging 1.00
shrinkage UTSW 8 45018037 missense probably damaging 1.00
F5493:Fat1 UTSW 8 45025480 missense probably damaging 0.99
I2289:Fat1 UTSW 8 45024996 missense probably benign 0.01
IGL02837:Fat1 UTSW 8 45017434 missense probably benign 0.00
PIT4283001:Fat1 UTSW 8 45029540 missense probably damaging 1.00
PIT4283001:Fat1 UTSW 8 45037207 missense probably damaging 1.00
PIT4576001:Fat1 UTSW 8 45024645 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0040:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R0078:Fat1 UTSW 8 44953299 missense probably damaging 1.00
R0197:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0328:Fat1 UTSW 8 45023790 missense probably benign 0.35
R0367:Fat1 UTSW 8 45024313 missense probably damaging 1.00
R0371:Fat1 UTSW 8 44951892 missense probably damaging 1.00
R0380:Fat1 UTSW 8 45010123 missense probably damaging 0.97
R0389:Fat1 UTSW 8 44950348 missense probably benign 0.00
R0433:Fat1 UTSW 8 45024649 missense possibly damaging 0.51
R0456:Fat1 UTSW 8 45029534 missense probably damaging 1.00
R0494:Fat1 UTSW 8 44950542 missense probably damaging 1.00
R0506:Fat1 UTSW 8 45022951 missense probably damaging 0.99
R0512:Fat1 UTSW 8 44951332 nonsense probably null
R0624:Fat1 UTSW 8 45051168 missense possibly damaging 0.46
R0701:Fat1 UTSW 8 45026553 missense probably benign 0.00
R0723:Fat1 UTSW 8 45026749 missense probably damaging 1.00
R0787:Fat1 UTSW 8 45040555 missense probably damaging 1.00
R0788:Fat1 UTSW 8 45023983 missense probably benign 0.27
R0862:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0864:Fat1 UTSW 8 45018037 missense probably damaging 1.00
R0907:Fat1 UTSW 8 45026598 missense probably benign 0.08
R0962:Fat1 UTSW 8 45033326 splice site probably benign
R1051:Fat1 UTSW 8 45044506 missense probably damaging 1.00
R1156:Fat1 UTSW 8 45039890 missense possibly damaging 0.94
R1237:Fat1 UTSW 8 45044279 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1468:Fat1 UTSW 8 45010545 missense probably damaging 1.00
R1478:Fat1 UTSW 8 45025622 missense probably damaging 0.99
R1482:Fat1 UTSW 8 44953244 missense probably benign 0.04
R1496:Fat1 UTSW 8 45033390 missense probably damaging 1.00
R1498:Fat1 UTSW 8 45025484 nonsense probably null
R1508:Fat1 UTSW 8 45026862 missense probably benign 0.01
R1577:Fat1 UTSW 8 45023383 missense probably benign 0.30
R1646:Fat1 UTSW 8 45018042 missense probably damaging 1.00
R1652:Fat1 UTSW 8 45025178 nonsense probably null
R1656:Fat1 UTSW 8 45025530 nonsense probably null
R1662:Fat1 UTSW 8 44953164 missense probably benign 0.20
R1672:Fat1 UTSW 8 45036835 missense probably damaging 1.00
R1704:Fat1 UTSW 8 45025576 missense probably damaging 1.00
R1708:Fat1 UTSW 8 45024792 missense probably damaging 1.00
R1710:Fat1 UTSW 8 45010482 missense probably benign 0.00
R1812:Fat1 UTSW 8 45036803 missense probably damaging 1.00
R1872:Fat1 UTSW 8 45038349 missense probably damaging 1.00
R1883:Fat1 UTSW 8 45051147 missense probably benign 0.17
R1893:Fat1 UTSW 8 45023856 missense probably damaging 1.00
R1930:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1931:Fat1 UTSW 8 45044228 missense possibly damaging 0.91
R1952:Fat1 UTSW 8 45033926 missense probably benign 0.00
R1957:Fat1 UTSW 8 45040682 missense probably damaging 1.00
R1999:Fat1 UTSW 8 44952393 missense probably damaging 0.96
R2019:Fat1 UTSW 8 45023746 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45024332 missense probably damaging 1.00
R2062:Fat1 UTSW 8 45026704 missense probably damaging 1.00
R2117:Fat1 UTSW 8 45037463 missense probably benign 0.33
R2196:Fat1 UTSW 8 45024646 missense probably damaging 1.00
R2204:Fat1 UTSW 8 45023700 missense probably damaging 1.00
R2256:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2257:Fat1 UTSW 8 44950371 missense probably damaging 1.00
R2409:Fat1 UTSW 8 45040530 splice site probably benign
R2416:Fat1 UTSW 8 45026383 missense probably damaging 1.00
R3021:Fat1 UTSW 8 45044011 missense probably damaging 1.00
R3108:Fat1 UTSW 8 45045173 splice site probably null
R3109:Fat1 UTSW 8 45045173 splice site probably null
R3196:Fat1 UTSW 8 44951868 missense probably benign 0.00
R3683:Fat1 UTSW 8 45017938 missense probably benign
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3732:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3733:Fat1 UTSW 8 44953269 missense possibly damaging 0.85
R3753:Fat1 UTSW 8 45025479 missense probably damaging 0.97
R3905:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3907:Fat1 UTSW 8 45023035 missense probably benign 0.00
R3908:Fat1 UTSW 8 45023035 missense probably benign 0.00
R4060:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4061:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4062:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4063:Fat1 UTSW 8 45025481 missense probably benign 0.09
R4078:Fat1 UTSW 8 44989122 missense probably damaging 0.99
R4105:Fat1 UTSW 8 45036851 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45010437 missense probably damaging 1.00
R4118:Fat1 UTSW 8 45050944 missense probably damaging 1.00
R4161:Fat1 UTSW 8 45036787 missense probably benign 0.00
R4364:Fat1 UTSW 8 44952962 missense probably benign 0.01
R4394:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4395:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4396:Fat1 UTSW 8 44952346 missense probably damaging 0.98
R4412:Fat1 UTSW 8 45023599 missense probably damaging 0.99
R4542:Fat1 UTSW 8 45041894 missense probably damaging 1.00
R4591:Fat1 UTSW 8 45026242 missense probably benign
R4606:Fat1 UTSW 8 44950683 missense possibly damaging 0.47
R4612:Fat1 UTSW 8 45025147 missense probably damaging 1.00
R4730:Fat1 UTSW 8 45033477 missense probably damaging 1.00
R4778:Fat1 UTSW 8 45038326 missense probably benign 0.04
R4824:Fat1 UTSW 8 44989114 missense probably damaging 1.00
R4829:Fat1 UTSW 8 45036162 missense probably damaging 1.00
R4832:Fat1 UTSW 8 45013065 missense possibly damaging 0.95
R4849:Fat1 UTSW 8 45012970 missense probably benign 0.15
R4896:Fat1 UTSW 8 44951280 missense possibly damaging 0.68
R4927:Fat1 UTSW 8 45022963 missense probably damaging 0.96
R4941:Fat1 UTSW 8 45036275 missense probably benign 0.00
R5011:Fat1 UTSW 8 45031263 critical splice acceptor site probably null
R5040:Fat1 UTSW 8 45023380 missense probably damaging 1.00
R5112:Fat1 UTSW 8 45024282 missense probably damaging 1.00
R5151:Fat1 UTSW 8 44951814 missense possibly damaging 0.74
R5161:Fat1 UTSW 8 44952512 missense probably benign 0.00
R5162:Fat1 UTSW 8 45025809 missense probably benign 0.02
R5353:Fat1 UTSW 8 45036131 missense probably benign 0.13
R5425:Fat1 UTSW 8 45025885 missense possibly damaging 0.64
R5458:Fat1 UTSW 8 45013053 missense probably damaging 1.00
R5479:Fat1 UTSW 8 45036875 missense possibly damaging 0.88
R5543:Fat1 UTSW 8 45023479 missense probably damaging 0.99
R5569:Fat1 UTSW 8 45039836 missense probably damaging 0.98
R5610:Fat1 UTSW 8 44953072 nonsense probably null
R5734:Fat1 UTSW 8 45051209 missense probably damaging 0.99
R5832:Fat1 UTSW 8 45017423 missense possibly damaging 0.65
R5860:Fat1 UTSW 8 45051129 missense probably benign
R5886:Fat1 UTSW 8 45027681 critical splice donor site probably null
R5886:Fat1 UTSW 8 45033395 missense probably damaging 1.00
R5919:Fat1 UTSW 8 45026873 critical splice donor site probably null
R5930:Fat1 UTSW 8 45044036 missense probably benign 0.10
R5960:Fat1 UTSW 8 45033368 missense probably damaging 1.00
R5988:Fat1 UTSW 8 45029456 missense probably benign 0.00
R6166:Fat1 UTSW 8 44952485 missense probably damaging 1.00
R6184:Fat1 UTSW 8 44953392 missense probably benign 0.00
R6208:Fat1 UTSW 8 45027613 missense probably damaging 0.99
R6351:Fat1 UTSW 8 45033495 missense probably damaging 1.00
R6391:Fat1 UTSW 8 44952342 missense possibly damaging 0.69
R6701:Fat1 UTSW 8 44950681 missense probably damaging 1.00
R6702:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6703:Fat1 UTSW 8 44953046 missense probably benign 0.28
R6704:Fat1 UTSW 8 45024373 missense probably damaging 1.00
R6822:Fat1 UTSW 8 45026404 missense probably damaging 1.00
R6852:Fat1 UTSW 8 45035598 missense possibly damaging 0.46
R6863:Fat1 UTSW 8 45044464 missense probably damaging 1.00
R6885:Fat1 UTSW 8 44952452 missense possibly damaging 0.94
R6912:Fat1 UTSW 8 45051023 missense probably benign 0.00
R6927:Fat1 UTSW 8 45024495 missense probably benign 0.41
R6964:Fat1 UTSW 8 45043945 missense probably damaging 1.00
R7010:Fat1 UTSW 8 44953349 nonsense probably null
R7062:Fat1 UTSW 8 44950216 start codon destroyed probably null 0.99
R7063:Fat1 UTSW 8 45040775 missense probably benign 0.09
R7071:Fat1 UTSW 8 44989108 missense possibly damaging 0.67
R7117:Fat1 UTSW 8 45031468 missense probably damaging 0.98
R7146:Fat1 UTSW 8 44950925 missense probably benign
R7210:Fat1 UTSW 8 45023503 missense probably damaging 1.00
R7227:Fat1 UTSW 8 45010609 missense probably benign 0.08
R7270:Fat1 UTSW 8 45037438 missense probably damaging 1.00
X0064:Fat1 UTSW 8 45025734 missense possibly damaging 0.58
Z1088:Fat1 UTSW 8 45023807 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGTGAGATACAGCCTCCTG -3'
(R):5'- GAGATTAACAGCACTTGCCTG -3'

Sequencing Primer
(F):5'- TCACGGAGAAGGCCACTTTG -3'
(R):5'- GATTAACAGCACTTGCCTGTTTCTTC -3'
Posted On2014-06-30