Incidental Mutation 'R1872:Ticam1'
ID210896
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
MMRRC Submission 039894-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1872 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56271897 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 66 (M66K)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably benign
Transcript: ENSMUST00000058136
AA Change: M66K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: M66K

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,844 C133Y unknown Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 A G 8: 79,690,251 M377T possibly damaging Het
Adam25 A T 8: 40,755,226 R510* probably null Het
Adamts12 G T 15: 11,217,880 E308* probably null Het
Adgrg3 C A 8: 95,033,442 N96K possibly damaging Het
Afdn T C 17: 13,881,316 V1022A probably damaging Het
Akap9 T C 5: 4,001,406 V1391A probably damaging Het
Akip1 A G 7: 109,711,775 Y174C probably damaging Het
Ap3b2 T C 7: 81,464,150 T830A unknown Het
Aph1a A G 3: 95,895,564 T159A probably damaging Het
Ccdc146 T C 5: 21,301,290 T718A probably benign Het
Cdk5r2 T C 1: 74,855,822 L242P probably damaging Het
Cep97 T A 16: 55,927,866 N67I probably damaging Het
Chic2 A T 5: 75,011,479 W121R possibly damaging Het
Clock A G 5: 76,248,462 S147P possibly damaging Het
Cntnap5a T G 1: 116,089,210 S178A probably benign Het
Col11a2 C A 17: 34,062,555 probably benign Het
Col6a3 T A 1: 90,830,214 H6L probably damaging Het
Cpne5 T C 17: 29,204,693 N154D probably benign Het
Ctsz T G 2: 174,427,976 K273Q probably benign Het
Cybrd1 G A 2: 71,129,760 V101M probably benign Het
Cyp2c23 T A 19: 44,005,551 K459* probably null Het
Cyp4a31 A T 4: 115,574,736 H419L probably damaging Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dnah9 C T 11: 66,037,490 V2118M probably benign Het
Doxl2 A G 6: 48,975,620 I160V probably benign Het
Dtna T C 18: 23,597,560 probably null Het
Ednra C T 8: 77,720,396 V18I possibly damaging Het
Elac1 T C 18: 73,742,646 R105G probably benign Het
Exoc2 A G 13: 30,822,661 S844P probably benign Het
Fam185a A T 5: 21,480,330 probably null Het
Fam204a A G 19: 60,199,449 M233T possibly damaging Het
Fat1 T A 8: 45,038,349 Y3816N probably damaging Het
Fat1 C A 8: 44,953,304 H1031N probably benign Het
Fbxo38 C T 18: 62,517,023 R621Q probably benign Het
Fhod3 C A 18: 25,130,610 R1524S probably damaging Het
Fnip1 A T 11: 54,487,735 R192W probably damaging Het
Frem3 T A 8: 80,612,576 H499Q probably damaging Het
Gab2 C T 7: 97,299,043 T280I probably damaging Het
Gdpgp1 A G 7: 80,238,424 R68G probably benign Het
Gm10382 C T 5: 125,389,560 probably benign Het
Gm4858 T A 3: 93,074,422 L249H probably damaging Het
Gmps A G 3: 64,001,517 H480R probably benign Het
Hecw1 G A 13: 14,280,449 R674* probably null Het
Herc2 T A 7: 56,157,509 F2478L probably benign Het
Homer2 C T 7: 81,636,402 V21M probably damaging Het
Ifna9 A G 4: 88,592,255 M44T probably damaging Het
Igfl3 A G 7: 18,179,896 D57G possibly damaging Het
Jcad T C 18: 4,673,048 M270T probably benign Het
Kdm5b T C 1: 134,624,994 L1236P probably damaging Het
Kif14 T A 1: 136,486,358 L724Q probably damaging Het
Lhb T C 7: 45,421,333 V45A probably damaging Het
Lhpp A G 7: 132,634,087 N134D probably benign Het
Mas1 T C 17: 12,842,191 Y115C probably damaging Het
Mb21d1 T C 9: 78,433,202 D416G probably benign Het
Mgam A T 6: 40,661,300 K395* probably null Het
Mms22l A G 4: 24,598,807 N1134S probably damaging Het
Mrc1 A G 2: 14,325,381 probably null Het
Mrgprg G A 7: 143,764,544 S277L probably damaging Het
Mrpl49 G T 19: 6,056,980 P60T possibly damaging Het
Mrps10 G A 17: 47,372,452 G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 Y120C probably damaging Het
N4bp2 C T 5: 65,794,518 probably benign Het
Nbea A G 3: 55,642,889 V2706A probably benign Het
Nfic T A 10: 81,420,684 M71L possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1112 A G 2: 87,191,878 T64A possibly damaging Het
Olfr115 G T 17: 37,609,912 P280T probably damaging Het
Olfr1202 T A 2: 88,817,936 V255E probably benign Het
Olfr1234 A G 2: 89,362,589 L280P probably damaging Het
Pak7 T C 2: 136,085,588 I655V possibly damaging Het
Pip5k1c A G 10: 81,306,319 N121S probably damaging Het
Plce1 A T 19: 38,760,077 I1737F probably damaging Het
Prrt1 T C 17: 34,630,951 L113P probably damaging Het
Ptprq T A 10: 107,643,999 T1137S probably benign Het
Recql5 T C 11: 115,923,309 I223V probably benign Het
Reg3g A T 6: 78,467,853 Y47* probably null Het
Rgs12 T G 5: 34,965,821 M316R probably damaging Het
Ric1 T C 19: 29,602,668 S1290P probably benign Het
Rpl36al A G 12: 69,182,923 C72R probably damaging Het
Rplp0 T A 5: 115,563,315 F275L possibly damaging Het
Rpp30 G A 19: 36,087,393 V89I probably benign Het
Ryr3 A G 2: 112,709,137 F3253L possibly damaging Het
Serpina3n A T 12: 104,408,944 N92Y probably benign Het
Setd7 G T 3: 51,542,831 T58N probably benign Het
Sh3tc2 T A 18: 62,011,883 L1136Q probably damaging Het
Slc35b4 G A 6: 34,158,505 Q291* probably null Het
Soga1 A G 2: 157,040,261 C624R possibly damaging Het
Sort1 A G 3: 108,340,695 N452S probably benign Het
Sympk A G 7: 19,029,145 I46V probably benign Het
Syngr2 T C 11: 117,812,538 V60A probably damaging Het
Syt17 A T 7: 118,408,118 F318I probably benign Het
Tgfb1 T A 7: 25,692,466 L149M probably damaging Het
Tmem131 G T 1: 36,807,927 D1363E probably benign Het
Tns4 A C 11: 99,080,100 D261E probably damaging Het
Trim30a T C 7: 104,429,210 N220D probably benign Het
Trmt10a T C 3: 138,156,720 L257P probably damaging Het
Troap G T 15: 99,075,352 probably benign Het
Ttc6 T C 12: 57,704,552 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vav1 A C 17: 57,324,750 K775T probably damaging Het
Vmn1r236 A G 17: 21,287,411 K264E possibly damaging Het
Vmn1r84 A G 7: 12,362,628 V46A probably benign Het
Wdr59 A T 8: 111,459,017 W835R probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp7 T G 15: 76,891,777 I673S probably benign Het
Zmynd11 A G 13: 9,698,701 I108T possibly damaging Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATATCTGAACTGCACCGATCCC -3'
(R):5'- TGTGGCTCCAGGCTTCATTC -3'

Sequencing Primer
(F):5'- CTCATTCTGGAGTTGGCCCAG -3'
(R):5'- TGGATAACCCAGGGCCTTC -3'
Posted On2014-06-30